ID: 982181076

View in Genome Browser
Species Human (GRCh38)
Location 4:152748820-152748842
Sequence TCATGTCGAGGTGGGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 312}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982181076_982181092 28 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181092 4:152748871-152748893 AGCAGGTTGATGGCGGTAGGGGG 0: 1
1: 0
2: 11
3: 53
4: 250
982181076_982181082 -5 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181082 4:152748838-152748860 CATGAACAGCCTGGGCACTGTGG No data
982181076_982181084 3 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181084 4:152748846-152748868 GCCTGGGCACTGTGGGCTCGTGG 0: 1
1: 0
2: 4
3: 41
4: 312
982181076_982181086 11 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181086 4:152748854-152748876 ACTGTGGGCTCGTGGACAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 225
982181076_982181083 -4 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181083 4:152748839-152748861 ATGAACAGCCTGGGCACTGTGGG 0: 3
1: 3
2: 13
3: 110
4: 601
982181076_982181089 25 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181089 4:152748868-152748890 GACAGCAGGTTGATGGCGGTAGG 0: 1
1: 0
2: 15
3: 41
4: 181
982181076_982181090 26 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181090 4:152748869-152748891 ACAGCAGGTTGATGGCGGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 95
982181076_982181088 21 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181088 4:152748864-152748886 CGTGGACAGCAGGTTGATGGCGG 0: 1
1: 4
2: 20
3: 37
4: 204
982181076_982181087 18 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181087 4:152748861-152748883 GCTCGTGGACAGCAGGTTGATGG No data
982181076_982181091 27 Left 982181076 4:152748820-152748842 CCTGCAGGCCCACCTCGACATGA 0: 1
1: 0
2: 2
3: 16
4: 312
Right 982181091 4:152748870-152748892 CAGCAGGTTGATGGCGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982181076 Original CRISPR TCATGTCGAGGTGGGCCTGC AGG (reversed) Intronic