ID: 982181505

View in Genome Browser
Species Human (GRCh38)
Location 4:152752090-152752112
Sequence GTTCTCAGGAGACTCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 9, 2: 60, 3: 103, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982181505_982181509 25 Left 982181505 4:152752090-152752112 CCCACTTTGAGTCTCCTGAGAAC 0: 1
1: 9
2: 60
3: 103
4: 298
Right 982181509 4:152752138-152752160 CTCCACTTTGCTCACCCTCCAGG 0: 1
1: 1
2: 0
3: 28
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982181505 Original CRISPR GTTCTCAGGAGACTCAAAGT GGG (reversed) Intronic
900581205 1:3410552-3410574 GTTCTCAGGAGGCCCCAACTCGG - Intronic
904551827 1:31325215-31325237 GCTCTCAGGAGACCCAAAGTAGG - Intronic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
904732687 1:32606803-32606825 CTTTTAAGGAGACTCAAAGCGGG + Intronic
906051775 1:42880474-42880496 GCTCTCAGGAGACCCAATGTAGG + Intergenic
907596524 1:55725428-55725450 GTTCTCAGGTAACTTAAAGCTGG + Intergenic
907985383 1:59524742-59524764 GCTCTCAGAAGACCCAAAGTGGG - Intronic
908203688 1:61823265-61823287 CATCTCAGGAGCCTCAAAGATGG - Intronic
908338925 1:63156384-63156406 GTCATCAGGAGATGCAAAGTAGG - Intergenic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
910068328 1:83181243-83181265 ATGCTCAGGGGATTCAAAGTAGG + Intergenic
910101420 1:83582496-83582518 AGCCTCAGGAGACCCAAAGTGGG + Intergenic
911025729 1:93434200-93434222 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
911858792 1:102918748-102918770 ATTCTCATAAGAGTCAAAGTTGG + Intronic
911935136 1:103960509-103960531 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912062115 1:105686645-105686667 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912062121 1:105686685-105686707 GTTCTCAAGAGACTCAAGGTGGG + Intergenic
912094506 1:106121492-106121514 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
912585256 1:110757975-110757997 GTTTTAAGGAGACTCAGAGGTGG - Intergenic
913479931 1:119278264-119278286 GTTCTAAGGAGCTTCACAGTGGG - Intergenic
913709762 1:121471179-121471201 TTTCACAGGAGAATCAAAGATGG - Intergenic
915245701 1:154555043-154555065 GTTCTTAGGAGAATTAAACTAGG - Intronic
916633742 1:166645223-166645245 TTTCTCAGGAAACTAAAAATAGG + Intergenic
916914670 1:169393134-169393156 GTTCTCTGCAGACACCAAGTAGG - Intronic
917961702 1:180150841-180150863 CTACTCAGGAGACTCACAGAAGG + Intergenic
919253950 1:195097009-195097031 GCTCTCAGGAGACCCATAGAGGG - Intergenic
919264045 1:195238075-195238097 ACTCTCAGGAGACCCGAAGTGGG - Intergenic
919302798 1:195791404-195791426 GTTCTCAGGAGACCCGAAGTAGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921358376 1:214307615-214307637 GTGCTCAGAAGACTCAGACTCGG - Intronic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921675283 1:217969108-217969130 GCTCTCAGGAAACCCAAAGTGGG - Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
922141640 1:222893957-222893979 GTTCTCAGGAGACCCGAAGTGGG + Intronic
923328205 1:232899005-232899027 GCTCTCAGGTGACCCAAAGTGGG - Intergenic
1064010359 10:11730485-11730507 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1065539937 10:26753647-26753669 TTTCTTATGACACTCAAAGTGGG - Intronic
1065830355 10:29609080-29609102 GCTGTCAGGAGACCCAAAGTGGG - Intronic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1068137466 10:52965080-52965102 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1068287692 10:54961704-54961726 GTACAGAGGAGACCCAAAGTGGG - Intronic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068300417 10:55131620-55131642 GCTCTTAAGAGACCCAAAGTGGG + Intronic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1068828063 10:61462064-61462086 GGTCTATGGAGACTCAAAGAGGG + Intergenic
1068919281 10:62465653-62465675 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1068938481 10:62658248-62658270 GCTCTCAGGAGACACAAAGTGGG - Intronic
1069212553 10:65779734-65779756 GCTTTCAGGAGACCCAAAGTGGG - Intergenic
1069377623 10:67809824-67809846 GGACTTTGGAGACTCAAAGTGGG + Intronic
1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG + Intergenic
1069561738 10:69435601-69435623 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
1069942969 10:71967720-71967742 GTTCTCAAAGAACTCAAAGTAGG - Intronic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1070297744 10:75178224-75178246 GTTCACAGCAGACCCAAATTGGG - Exonic
1070653762 10:78256642-78256664 GGTCTCAGGAGAATTAAAGCAGG - Intergenic
1071052970 10:81473618-81473640 GCTCTCAGGAGACAAAAAGTGGG - Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071819318 10:89264322-89264344 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1072440665 10:95451778-95451800 ATTCTCAGGAGAATCAAGGTAGG + Intronic
1072550336 10:96472458-96472480 TCTCTCAAGAGCCTCAAAGTTGG + Intronic
1072871252 10:99123691-99123713 GCTCTCAGGAGATCCAAGGTGGG + Intronic
1073749303 10:106505913-106505935 GTTCTCATGGGAATCAAAATAGG - Intergenic
1074301762 10:112240006-112240028 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1075772755 10:124954076-124954098 CTACTCAGGAGGCTGAAAGTGGG - Intronic
1077609932 11:3637819-3637841 GATCTGAGGAAACTCAAAGTAGG - Intergenic
1077938893 11:6818690-6818712 CCTCTCAGGAGACCCAGAGTGGG - Intergenic
1078345499 11:10544460-10544482 GCTCTCAGGAGACTCTAAGTGGG + Intergenic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1079997034 11:27305507-27305529 GCTCTCAGGAGACTGGAAGTGGG - Intergenic
1080444814 11:32328599-32328621 GTTTTCTGGAAACTCAGAGTAGG - Intergenic
1080851949 11:36077992-36078014 GCTCAGAGGAGACTCACAGTGGG + Intronic
1081010953 11:37812037-37812059 GCTCCCAGGAGACCCAAAATGGG + Intergenic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1082752335 11:57032560-57032582 GTTTGCAGGATACTCAAAGAAGG + Intergenic
1083916136 11:65744791-65744813 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1084733268 11:71088453-71088475 GTTCTCAGTCAACTCAAAGTCGG - Intronic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1085496925 11:76978487-76978509 GCTCTTGGGAGACCCAAAGTGGG - Intronic
1087534356 11:99424920-99424942 GCTCAGAGGAAACTCAAAGTGGG + Intronic
1089601293 11:119616910-119616932 GGTCTCAGGAGGGTCAGAGTAGG - Intergenic
1090045243 11:123326166-123326188 TTTCACAGGAGTCTCAAAATTGG + Intergenic
1093196407 12:16134723-16134745 TTTCTCAAGAGAGTCAAAGAAGG - Intergenic
1093317179 12:17666433-17666455 GCTCTCAGGAGACTGGAAGTGGG + Intergenic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1094068545 12:26387215-26387237 GTGCACTGGAGACTCAAATTTGG + Intronic
1095271756 12:40226739-40226761 GTTCTTTTAAGACTCAAAGTCGG + Intronic
1095444045 12:42267360-42267382 GGTCTCAGGAGATCTAAAGTGGG + Intronic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1097684271 12:62677165-62677187 GTGCTCAGGAGACCTGAAGTGGG - Intronic
1098519609 12:71420782-71420804 GCTCTCAGGACACCCACAGTGGG + Intronic
1098790611 12:74817224-74817246 GTTCTTAGGAGACCTGAAGTGGG - Intergenic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099033775 12:77560390-77560412 GCTCTCAGGATACCCAAAGTGGG - Intergenic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1099557615 12:84129039-84129061 GTTCTCAGGAGACCCGGAGTGGG - Intergenic
1099696423 12:86027011-86027033 GTTCTCAGTATACTATAAGTAGG + Intronic
1100726238 12:97411987-97412009 GTTCTCAAGAAGCTCATAGTTGG + Intergenic
1101124423 12:101616296-101616318 GTTCTCAGTGTACTCAATGTTGG - Intronic
1101523514 12:105506550-105506572 CTGGTCAGGACACTCAAAGTTGG - Intergenic
1103173721 12:118843987-118844009 GCTCTCAGGAGACTTTAAGTGGG - Intergenic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1107841206 13:44459422-44459444 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1108249644 13:48551485-48551507 GTTCTCAGGAGACCCTAAGTGGG - Intergenic
1109348517 13:61145846-61145868 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109687835 13:65844165-65844187 GTTCTCAGGAGACCTGCAGTGGG - Intergenic
1109780816 13:67107599-67107621 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1110439097 13:75507753-75507775 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111268875 13:85854058-85854080 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1111304031 13:86382839-86382861 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1111485744 13:88896210-88896232 GCTCTCAGGAGACTCAAAGTAGG - Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1113138752 13:107123053-107123075 TTTCTCAGGTGACTCACACTGGG - Intergenic
1113147923 13:107229569-107229591 GTCCACAGGAGATTCAAAGTGGG + Intronic
1113229342 13:108195252-108195274 GCTCTCAAGAGACCCAAAATGGG - Intergenic
1113502349 13:110786553-110786575 GTTCTCAGTAGAAACAAGGTAGG + Intergenic
1115267015 14:31511129-31511151 GTACTCAGGAGACCCAAAACTGG + Intronic
1115310542 14:31974432-31974454 GCCCTCAGGAGACCCGAAGTGGG + Intergenic
1116159715 14:41253370-41253392 GCTCTCAGGAGACCGGAAGTGGG + Intergenic
1116617312 14:47155158-47155180 GGTCTCAGGAGACCTGAAGTGGG - Intronic
1116789952 14:49329669-49329691 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1117436620 14:55721031-55721053 GAAGTCAGGAGACACAAAGTTGG + Intergenic
1117472651 14:56061948-56061970 GTTCTTAGGAAATTCAAACTGGG + Intergenic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1121976355 14:98407704-98407726 GTTCTGTGGACACTCACAGTCGG + Intergenic
1122386039 14:101348967-101348989 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1122831519 14:104399641-104399663 GGTCTCAGGACACTCAGGGTAGG + Intergenic
1123033413 14:105461746-105461768 GTCCTCAGGAGCCTCACAGCTGG - Intronic
1123986647 15:25652436-25652458 GTTGTCAGCAGAATCAAAGGAGG - Intergenic
1126979598 15:54227126-54227148 GTTTTCAGGAGACCCAAAGTGGG + Intronic
1126990806 15:54373908-54373930 GCTCTCTGGAGACTCGAAGTGGG + Intronic
1131568286 15:93506192-93506214 GCTCTCAGAAGACTCGCAGTGGG + Intergenic
1131720981 15:95168846-95168868 ATTCTCAGGAGTTTCAAAGAGGG + Intergenic
1132281572 15:100620742-100620764 GTTTTTAGAAGACTCAAAATTGG - Intronic
1132381116 15:101367430-101367452 GTTCTCTGAACACTCAATGTAGG + Intronic
1134867029 16:17617614-17617636 GATCTCAGGAGTCTGAATGTTGG - Intergenic
1135143992 16:19945753-19945775 GTACTCAGGAGAGTCAGAGAAGG + Intergenic
1135167368 16:20151390-20151412 ATTTTCAGGAGACTGAAATTCGG - Intergenic
1135986836 16:27190115-27190137 GCTCTCAGGAGACCAGAAGTGGG - Intergenic
1137343952 16:47637186-47637208 GCTCCCAGGAGACCCAAAGTGGG - Intronic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1139015514 16:62684527-62684549 GTTCTCGGGAGACCCAAAGTGGG - Intergenic
1139143138 16:64292568-64292590 GTTCTCCTGAGATTCAAACTAGG + Intergenic
1139151006 16:64381686-64381708 GATCTCAGGAGACCCGAAATGGG - Intergenic
1139368792 16:66451928-66451950 CTTCTCAGGATACTAAACGTTGG + Intronic
1144553376 17:16260688-16260710 ATTCTCAGGAGACCCAAAGTGGG - Intronic
1147884500 17:43675647-43675669 GGGCTCAGGAGACTCAGAGGAGG + Intergenic
1148389936 17:47264193-47264215 ATTTTCAGGGAACTCAAAGTGGG + Intronic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1149256833 17:54836663-54836685 GTTCTCAGGAGACCTGGAGTGGG + Intergenic
1150201441 17:63361840-63361862 GCTCTCAAGAGATCCAAAGTGGG + Intronic
1150533690 17:66013568-66013590 GTTCTCTGGTCCCTCAAAGTTGG + Intronic
1150868647 17:68880299-68880321 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1151746179 17:76013136-76013158 GTTCCCAGGTGAATAAAAGTGGG - Intronic
1153409456 18:4777505-4777527 GTTCTCAGGGGGCTCACAGCAGG + Intergenic
1153428764 18:4992831-4992853 GCTCCTAGGAGACCCAAAGTTGG + Intergenic
1155215811 18:23642055-23642077 CCTCCCAGGAGACCCAAAGTGGG - Intronic
1155431472 18:25764058-25764080 GCTCTCAGGTGCCTCAAAGCAGG - Intergenic
1156234868 18:35192781-35192803 GTTTTCAGCAAAATCAAAGTGGG - Intergenic
1159161296 18:64646439-64646461 GCTCTCAGGGGACCCAAAGTAGG + Intergenic
1159382383 18:67677311-67677333 CTGCTGAGAAGACTCAAAGTTGG + Intergenic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1160474122 18:79167343-79167365 GCTCTCAGGAGACGCTAAGTGGG + Intronic
1160599661 18:80002978-80003000 GTCCTCAGGTGAGTCCAAGTAGG + Intronic
1161729264 19:5949014-5949036 GTTCTGACGAGACTAAAAGATGG + Intronic
1161735122 19:5987474-5987496 TTTCACAGGGGACACAAAGTTGG - Intergenic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1168095021 19:54109562-54109584 GTTCTGTGGAGACACACAGTGGG + Intronic
926353396 2:12017751-12017773 CTTCTGAGGAGAATCAGAGTGGG - Intergenic
928327162 2:30328511-30328533 GTTCTCAGGATGCTCAGAGTTGG - Intergenic
928470235 2:31568420-31568442 GCTCTCGGGAGACCCAAAGTGGG + Intronic
928637921 2:33266735-33266757 GCTCTCAGGATACCCACAGTGGG - Intronic
928820478 2:35355598-35355620 GCTCTCAGGAGACACAAAGTGGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929847082 2:45541552-45541574 GCTCTCAGAAGACCCAAAGCGGG + Intronic
930313585 2:49771596-49771618 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
930503004 2:52246624-52246646 GTTCTTAGGACACTTAATGTTGG + Intergenic
930681460 2:54260952-54260974 ATTGACAGGAGACTCAAAGCTGG + Intronic
931512131 2:63010487-63010509 TTACTTAGGAGACTCAAATTAGG - Intronic
931733824 2:65176833-65176855 GTTCTCAGGAGACCCAAATTGGG + Intergenic
931751190 2:65331581-65331603 GTTCACAGAAGACTCCAAATAGG + Intronic
932214675 2:69959023-69959045 GTTCCCAGGAGAATCACAGCTGG + Intergenic
932398217 2:71462654-71462676 GCTCTCAGGAAACCCGAAGTGGG + Intronic
932644598 2:73487753-73487775 GTTTTCAGGAGACCCAAAGTGGG + Intronic
933042632 2:77487885-77487907 GGTCTCAGGAGACCCGAAGTGGG - Intronic
933113104 2:78429634-78429656 GCTCAGAGGAGACTCACAGTGGG - Intergenic
933420888 2:82043698-82043720 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
933454955 2:82508393-82508415 GTTCTCAGGAGACCCAAAGTCGG - Intergenic
933606485 2:84389621-84389643 GCTCTCAGGAGACCCAAAGTTGG + Intergenic
934776913 2:96945031-96945053 GTTCTCAGGAGGCTAATAGGTGG - Intronic
935299598 2:101682462-101682484 GGTCCCAGGAGACTCAGAGCTGG + Intergenic
935667588 2:105525859-105525881 GCTCTCAAGAGACCCAAAGTAGG - Intergenic
935985932 2:108673326-108673348 ATTCTCAGGAGACGCATACTGGG - Intronic
936904322 2:117519640-117519662 GTTCTCAGGAAAAACTAAGTAGG + Intergenic
937370802 2:121296044-121296066 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
938015568 2:127864376-127864398 GTAATCAGGAGACTCAATGCAGG + Exonic
938732516 2:134157884-134157906 GTTCTCAGAATACTTGAAGTGGG + Intronic
939837717 2:147150639-147150661 GCTTTCAGGAGACCCAAATTGGG - Intergenic
940074754 2:149728937-149728959 GTTGTCAGAAGACTCAAGCTAGG + Intergenic
940422799 2:153499248-153499270 GCTCTCAGGAGACCCAAAATGGG + Intergenic
940956916 2:159738526-159738548 GCTCTCAGGAGACCCAAAGTGGG + Intronic
941151450 2:161919610-161919632 GTTCTCAGGAGGCCCAAAGTGGG - Intronic
941678154 2:168366284-168366306 TTTCTCAGGAGTGTCAAAGTAGG + Intergenic
941998914 2:171627122-171627144 GCTCTCAGGAGACCCAAAATGGG - Intergenic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
943179391 2:184524321-184524343 GCTCTCAGGAGACCCCAAATGGG + Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
943426954 2:187749630-187749652 GCTCAGAGGAGACTCACAGTGGG + Intergenic
943928460 2:193819388-193819410 GTTCTCAGGAGACCCACAGTAGG + Intergenic
943932194 2:193868358-193868380 GAACTGAGGAGACCCAAAGTGGG - Intergenic
943932212 2:193868482-193868504 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
943960268 2:194254775-194254797 GCTCTCAGAAGACCCAAAGTGGG - Intergenic
944146793 2:196514769-196514791 GCTCTCAGGAGACTCAGAGTGGG - Intronic
944680412 2:202072296-202072318 TTTCTCAGGAGACTTGAACTTGG + Intergenic
945721370 2:213421936-213421958 GCTCTCAGGAGACCCAAAGTGGG - Intronic
945721509 2:213422813-213422835 GTTCTCAGGTTACACAAAGATGG - Intronic
946208248 2:218126421-218126443 GTTCTCAGGGGCCTCAGAGGAGG - Intronic
946701968 2:222423935-222423957 GTACCCAGGAGGTTCAAAGTGGG - Intergenic
946733128 2:222728269-222728291 GCTCTCAGGAAAATTAAAGTGGG - Intergenic
948293014 2:236841493-236841515 GTTCTCAGCACACACCAAGTGGG + Intergenic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
948434598 2:237944495-237944517 GCTCTCAGGAGACCCAGAGTGGG - Intergenic
1169781118 20:9311705-9311727 GATCTCAGGAGAGTCTGAGTAGG - Intronic
1169880543 20:10341923-10341945 GTGCTCAGGAGACCCTAAGTGGG - Intergenic
1170119457 20:12895722-12895744 CTTCTCAGGGAACTCTAAGTTGG + Intergenic
1170221608 20:13947446-13947468 GCTTTCAGGAGACCCAAAGTGGG - Intronic
1170314884 20:15031491-15031513 GCTCTCAGGAAACCCATAGTGGG + Intronic
1170327893 20:15176597-15176619 GCCCTCAGGAGACCCGAAGTGGG - Intronic
1170914401 20:20608798-20608820 GTTGTCATGAGAATCAGAGTGGG - Intronic
1171286050 20:23938739-23938761 GCTCTCAGGAGACCCAAGATGGG - Intergenic
1171324752 20:24281608-24281630 GGTCTGAGGAGACTCCAAGGAGG + Intergenic
1173207555 20:41006789-41006811 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1175138610 20:56843114-56843136 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1177037352 21:16060545-16060567 GCTCTCAGGAGATCCAAAGTGGG + Intergenic
1177305773 21:19313606-19313628 GTTCTCATCAGACTCAATTTTGG - Intergenic
1177344610 21:19853720-19853742 GCTCTCAGGGGACCCGAAGTGGG + Intergenic
1177459950 21:21397067-21397089 GCTCTCAGTAGACCCTAAGTGGG + Intronic
1178937464 21:36875638-36875660 GCTCTCAGGAGACTTGAAGTGGG - Intronic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1181368215 22:22396495-22396517 GTTCTGAAGAAGCTCAAAGTTGG + Intergenic
1182185581 22:28398263-28398285 GTGCTCAGGAGACACAAAGAGGG + Intronic
1182530506 22:30952191-30952213 GTCATAAGGAGACTCAAACTGGG + Intronic
1182768269 22:32774543-32774565 GTTTTCAGGAGCCTCAAATAAGG + Intronic
1183250807 22:36729107-36729129 CTTCTCAGGACACTCACAGCAGG + Intergenic
1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG + Intronic
951772694 3:26276335-26276357 ATTCTCTGGAGAGTCAAATTAGG + Intergenic
952462031 3:33537839-33537861 GTTCTTACAAGACTCAATGTGGG + Intronic
952657319 3:35801820-35801842 GCCCTCAGGAGACTCAGAGTGGG + Intergenic
953263588 3:41364040-41364062 CTACTCAGGAGGCTGAAAGTGGG - Intronic
953289895 3:41650134-41650156 GCTCCCAGGAGACCCAAAGTGGG - Intronic
953500278 3:43426430-43426452 GCTCTCAGGGGCCTCAAATTAGG - Intronic
954498081 3:50983631-50983653 GCTCAGAGGAGACTCACAGTGGG - Intronic
955111848 3:55958121-55958143 GCTCTCAGGAGACCCGAAATGGG + Intronic
957156512 3:76551230-76551252 GAATTGAGGAGACTCAAAGTGGG - Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
957646700 3:82939568-82939590 GCTCTCAGGGGACCCAAAGTGGG - Intergenic
958561998 3:95759353-95759375 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
958584428 3:96068803-96068825 GCTCTCAGGAGACCCAAACTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
959252575 3:103966458-103966480 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
960459104 3:117911432-117911454 GTTCCCAGGAGACCCAGTGTTGG - Intergenic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
962413447 3:135161637-135161659 GACCTCAGCAGACTCAAACTAGG - Intronic
963250241 3:143096077-143096099 GCTCTCAAGAGAATCAAAGTGGG - Intergenic
963346314 3:144099601-144099623 GTTCTCAGAGGACCCAAAGTGGG - Intergenic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
965013962 3:163131885-163131907 GCTCTCAGGATTCCCAAAGTGGG - Intergenic
965073933 3:163953178-163953200 GTTCTCGGGAGACCCACAGTTGG + Intergenic
967355150 3:188560948-188560970 GTTCTCAGGAGTCCCACAGTAGG + Intronic
967915430 3:194574788-194574810 GTTCTCAGAAAACTCAGGGTAGG + Intergenic
968838289 4:2981399-2981421 GCTCTCAGGAGACCCAAAATGGG + Intronic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
971834600 4:31747726-31747748 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
972075294 4:35079478-35079500 GTGGAGAGGAGACTCAAAGTGGG - Intergenic
972374589 4:38458682-38458704 GCACTCTGGAGACTCAAAGAGGG + Intergenic
972788234 4:42346792-42346814 GCTCTCAGGAAACCCAGAGTGGG - Intergenic
973026860 4:45283985-45284007 GTTCTCAGGGGACCTGAAGTGGG + Intergenic
973206218 4:47563437-47563459 CTGCTCAGGAGAGTCAAAGGAGG - Intronic
973534485 4:51867510-51867532 GCTTTCAGCAGACCCAAAGTGGG + Intronic
974023484 4:56711813-56711835 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
974515041 4:62897601-62897623 GCTCTCAGGAGACCCAAACTGGG - Intergenic
974628940 4:64458145-64458167 GCTCTCAGGAGACCCATAGTGGG - Intergenic
974697976 4:65398840-65398862 GCTTTAAGGAGACCCAAAGTGGG - Intronic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975023598 4:69521092-69521114 GCTCTCAGGAGACCCTAAGTGGG - Intronic
975299772 4:72775626-72775648 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
977410325 4:96653813-96653835 GCTCTCAGGAGACCCAGGGTGGG - Intergenic
978498510 4:109384871-109384893 GCTCAGAGGAGACTCACAGTGGG - Intergenic
979010827 4:115366127-115366149 GCTCTCAGGAGACCCAAAATAGG - Intergenic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
979647469 4:123088281-123088303 GGTCTCAGGAGAGTCAAGGTGGG - Intronic
979648927 4:123107365-123107387 GCTCTCAGGAGACCCAACATAGG + Intronic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
982856179 4:160385389-160385411 GCTCTCAGGTGACCCAGAGTGGG + Intergenic
983323827 4:166227828-166227850 GCTCTCAGAAGACCCAAAGTTGG - Intergenic
984375381 4:178922596-178922618 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
986923564 5:12717687-12717709 GCTCAGAGGAGACTCACAGTGGG - Intergenic
987815962 5:22901464-22901486 GCTCTTAGGAGACCCAAAGTGGG + Intergenic
987875455 5:23675137-23675159 GCTCTCAGGAGCCCCAAAGTGGG - Intergenic
988346398 5:30042464-30042486 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
989163421 5:38412688-38412710 CTTCTCAGGAGACTTATGGTGGG - Intronic
989425398 5:41290602-41290624 GCTCTCAGGAGACCCAGAGTGGG + Intergenic
989537650 5:42582465-42582487 GTTCTCAGGAGACCTGAAGTGGG - Intronic
989730422 5:44641582-44641604 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
989821736 5:45800932-45800954 GGTCTCATGAGATCCAAAGTGGG - Intergenic
989967099 5:50477274-50477296 TTTCACAGGAGAATCAAAGATGG + Intergenic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
991230913 5:64331578-64331600 GTTCTCAGGAGACCCACAGTGGG - Intronic
992407422 5:76472825-76472847 TTTCTCAGGATCTTCAAAGTTGG + Intronic
994065301 5:95533408-95533430 GTTCTCAATACACTGAAAGTCGG + Intronic
994246899 5:97488773-97488795 GCTCTCAGGAGACTCATAGTGGG + Intergenic
994452062 5:99955660-99955682 GCTTTCAGGAGACCCAAAGTGGG + Intergenic
994692322 5:103034309-103034331 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
995112863 5:108446714-108446736 ATTCTCAGGAGAAACAAAGCAGG + Intergenic
995146071 5:108787834-108787856 GCTCTCAGGAGACTCAAAGTGGG - Intronic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
996270624 5:121600430-121600452 TTTCTCAGAAAACTAAAAGTAGG - Intergenic
996433700 5:123410228-123410250 GTTCACAGAAGACTCAATATTGG + Intronic
997223011 5:132184870-132184892 GTTTTCAGGGAACTCAAAATAGG + Intergenic
997982630 5:138478437-138478459 GTTCTAATGAGATTCAAAGGTGG - Intergenic
998222269 5:140294226-140294248 GCTCTCAGCAGAATCAAATTTGG - Intronic
999702645 5:154242304-154242326 GGCCTCAGGAGGTTCAAAGTGGG - Intronic
1000854192 5:166379096-166379118 GCTCTCAGGAGACTGCAAGTGGG + Intergenic
1002677989 5:180934983-180935005 ATTCTCAGGAGACCTGAAGTGGG + Intronic
1005594768 6:27368525-27368547 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006766205 6:36509235-36509257 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1008231644 6:48990463-48990485 GCTCTCAGAATACCCAAAGTGGG - Intergenic
1008330612 6:50240482-50240504 GCTCAGAGGAGACTCATAGTGGG + Intergenic
1009582742 6:65557808-65557830 GCTCTCAGGAGACCCAAAATGGG + Intronic
1010394982 6:75381138-75381160 GTTCTCAAGAGAGTGAAATTTGG - Intronic
1010559690 6:77333858-77333880 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1010698725 6:79013194-79013216 GTTTTCATGAGACCCAAAGGAGG + Intronic
1011284130 6:85705904-85705926 GCTCTCAGGAGACCCAAGATGGG + Intergenic
1012100858 6:95084217-95084239 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1012718012 6:102701554-102701576 GCTCTCAGGAGACACGAAATGGG + Intergenic
1012901731 6:105014076-105014098 GTGCAAAGGAAACTCAAAGTTGG - Intronic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1014391746 6:120872918-120872940 GCTCTCAAGAGACCCAGAGTGGG - Intergenic
1014391930 6:120873878-120873900 GTTCTCAAGAGACCCGAAGTAGG - Intergenic
1014418704 6:121214912-121214934 GCTCTCAGGAGACCAGAAGTGGG + Intronic
1014515605 6:122374799-122374821 ATTTTCAGAAGACTGAAAGTAGG + Intergenic
1016076711 6:139804821-139804843 GTTTTCAGGAAACCCAAAGTGGG + Intergenic
1016163258 6:140907848-140907870 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1016983286 6:149873339-149873361 ATTCTCAGGAGGCTAAAAATGGG - Intergenic
1017396248 6:154002877-154002899 GCTCTTGAGAGACTCAAAGTGGG + Intergenic
1017587977 6:155947588-155947610 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1020916139 7:14195428-14195450 GTTCTTAGGAGAATAAGAGTGGG - Intronic
1021198169 7:17695605-17695627 GTTCTCAGCACATTCAAGGTAGG + Intergenic
1021269974 7:18574090-18574112 GTTCTCAAGAGACCCAAAGTGGG + Intronic
1021343079 7:19488706-19488728 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1022391933 7:29950834-29950856 GCTCTCAGGGGACCCAAAGTGGG - Intronic
1024024672 7:45400310-45400332 GCTCTCAGGACACCCAAAGTAGG - Intergenic
1024857000 7:53794224-53794246 GTTCTCAGGAGACCCAAAGTGGG + Intergenic
1026295934 7:69052483-69052505 GTTCTCATAAGACTCAAATCTGG - Intergenic
1027275771 7:76553530-76553552 ATGCTCAGGGGATTCAAAGTAGG - Intergenic
1027343852 7:77237631-77237653 GGTCTCAGCAGACTCAAGCTGGG - Intronic
1027687338 7:81294509-81294531 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
1027734877 7:81920185-81920207 GCTCTCAGGGGGCCCAAAGTGGG + Intergenic
1027761186 7:82281144-82281166 GTTCTCAGGAGACTCTGGTTTGG + Intronic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1028401910 7:90433681-90433703 GCTTTTAGGAGACCCAAAGTTGG + Intronic
1028420638 7:90628722-90628744 TTACTCAGGAGACTCAAGGCGGG + Intronic
1030359490 7:108580047-108580069 GCTCTCAGGGAACCCAAAGTGGG - Intergenic
1030899235 7:115102058-115102080 GCTCTCAGAGGGCTCAAAGTAGG - Intergenic
1031033011 7:116755110-116755132 GTTTTCAGGAGATCCAAAGATGG - Intronic
1032463777 7:132130627-132130649 GTTCTCAGGAGGCACAAAGATGG + Intronic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1035108539 7:156461820-156461842 GTTCACAGGACACAAAAAGTGGG + Intergenic
1035629347 8:1096550-1096572 GTGCTCAGGAGAGTCAAGCTGGG + Intergenic
1035629458 8:1097000-1097022 GTGCTCAGGAGAGTCAAGCTGGG + Intergenic
1035629482 8:1097090-1097112 GTGCTCAGGAGAGTCAAGCTGGG + Intergenic
1035629574 8:1097450-1097472 GTGCTCAGGAGAGTCAAGCTGGG + Intergenic
1035735959 8:1887830-1887852 GTTCTGAGGAGACACTGAGTGGG + Intronic
1035736444 8:1890642-1890664 GTTGTGAGGAGACACTAAGTGGG + Intronic
1036907684 8:12720770-12720792 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1037349332 8:17933451-17933473 GTTCTAAGGAGAATCCCAGTGGG + Intronic
1039210107 8:35204283-35204305 GCTCTCAGGAGACTCAAAGTGGG + Intergenic
1040674375 8:49731542-49731564 GTCCTCAGAAAACTCACAGTGGG + Intergenic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1042209059 8:66359619-66359641 GTGATCAAGAGAATCAAAGTAGG + Intergenic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043695246 8:83208877-83208899 GCTCTCAGGAGATCCAAAGTGGG - Intergenic
1043702805 8:83312578-83312600 GTTCTCAGGAGACCCACAGTGGG + Intergenic
1043708000 8:83377889-83377911 GCTCTTGAGAGACTCAAAGTGGG + Intergenic
1043737662 8:83768269-83768291 GCTTTCAGGAGACCCACAGTGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1044053712 8:87542372-87542394 GCTCTCTAGAGACCCAAAGTGGG + Intronic
1044774903 8:95677909-95677931 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1045873415 8:106950660-106950682 GCTCTCAAGAGACCCAAAGTGGG - Intergenic
1046097816 8:109580991-109581013 GTTCCCATCAGTCTCAAAGTAGG - Intronic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1047318318 8:123754783-123754805 GCTCTCAGGAGACCCAATGTTGG + Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1049140530 8:140950066-140950088 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1049426512 8:142540318-142540340 GTTCACAGGAGACCCCAAGGGGG - Intronic
1049470605 8:142773572-142773594 GTTCTCAGGAGACTGAAGCTGGG + Intronic
1050426207 9:5515509-5515531 GCTTTCAGGAGACCCAAAGTGGG + Intronic
1050947986 9:11550122-11550144 GCACTCAGGAGATCCAAAGTGGG - Intergenic
1051352505 9:16211731-16211753 GCTCACAGGGGACTTAAAGTGGG + Intronic
1051355243 9:16234545-16234567 GTCCTCAGGAGACGCAAAGTGGG - Intronic
1052359457 9:27538513-27538535 GTTCTCAAGAGAAACAGAGTGGG - Intergenic
1052437172 9:28444060-28444082 GCTCTCAGGACACCCAAAGTTGG - Intronic
1052623558 9:30944617-30944639 GCTCTCAGGAGACACGAAGTTGG - Intergenic
1052691496 9:31821314-31821336 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1055483757 9:76736234-76736256 GCTTTCAAGAGACTCAATGTGGG + Intronic
1055816571 9:80213366-80213388 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1056994402 9:91443037-91443059 GCTCTCAAGAGACCTAAAGTGGG + Intergenic
1058545724 9:106059086-106059108 GTTTTCAGGAGACCTGAAGTGGG + Intergenic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1059681574 9:116590934-116590956 GCCCTCAGGAGACTTGAAGTGGG - Intronic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1060702781 9:125773370-125773392 GTTATCAGCAGACTCAGAGGTGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1062202378 9:135310347-135310369 GAGCTCAGTAGACTCAAAGGAGG + Intergenic
1062656505 9:137606554-137606576 GTTCTCAGCAGGCACAAAATCGG - Intronic
1185828852 X:3279242-3279264 AGACTCATGAGACTCAAAGTGGG + Intronic
1186223584 X:7374954-7374976 GTTCTCAGGAGACCCAAAATGGG + Intergenic
1186770606 X:12814424-12814446 GTTCTGAGGAGACTGTCAGTTGG - Intronic
1187745857 X:22408629-22408651 TTTCTAAGGAGACTCACAGCTGG - Intergenic
1188194974 X:27222373-27222395 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1188434940 X:30148909-30148931 GTTCTCAGGAGACCAGAAGTGGG - Intergenic
1190621235 X:52288622-52288644 GCTTTCAGGAGACCCAAAGTAGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1191016406 X:55814065-55814087 GATCTCAGGAGAACCACAGTGGG - Intergenic
1194212248 X:91082909-91082931 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1195880264 X:109586147-109586169 GCTCTCAGGAAACTCACAGTGGG + Intergenic
1197035718 X:121870833-121870855 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1197113925 X:122809186-122809208 GATTTCAGAGGACTCAAAGTAGG + Intergenic
1198189523 X:134288332-134288354 GCTCTCAGGAGACTTAAAGTGGG - Intergenic
1199640249 X:149853643-149853665 GTTCTTAGGTAAATCAAAGTAGG - Intergenic
1200749123 Y:6928932-6928954 GCTCTCAGGAGACCTAAAGTGGG + Intronic
1200977316 Y:9227074-9227096 GATCTCAGGAGACACAAAGTGGG + Intergenic
1201593111 Y:15637204-15637226 GTTCTAGGGAGACCCAGAGTGGG + Intergenic
1201855625 Y:18537345-18537367 GCTCTCAGGAGACAGAAAGCAGG - Intergenic
1201877696 Y:18783040-18783062 GCTCTCAGGAGACAGAAAGCAGG + Intronic
1202133496 Y:21635817-21635839 GATCTCAGGATACAAAAAGTGGG - Intergenic
1202172501 Y:22065877-22065899 GCTTTCAGGAGACAGAAAGTGGG + Intergenic
1202218862 Y:22520494-22520516 GCTTTCAGGAGACAGAAAGTGGG - Intergenic
1202324324 Y:23675557-23675579 GCTTTCAGGAGACAGAAAGTGGG + Intergenic
1202360790 Y:24107981-24108003 GCTCTCAGGAGACAGAAAGGAGG + Intergenic
1202509988 Y:25562137-25562159 GCTCTCAGGAGACAGAAAGGAGG - Intergenic
1202546447 Y:25994497-25994519 GCTTTCAGGAGACAGAAAGTGGG - Intergenic