ID: 982186684

View in Genome Browser
Species Human (GRCh38)
Location 4:152809020-152809042
Sequence TCTTCCTCTGTCGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558647
Summary {0: 227, 1: 20685, 2: 124731, 3: 218576, 4: 194428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982186684_982186688 2 Left 982186684 4:152809020-152809042 CCAGCCTGGGCGACAGAGGAAGA 0: 227
1: 20685
2: 124731
3: 218576
4: 194428
Right 982186688 4:152809045-152809067 CGTCTCAAAAAAAAAATAAGTGG 0: 1
1: 89
2: 863
3: 2801
4: 4095
982186684_982186689 28 Left 982186684 4:152809020-152809042 CCAGCCTGGGCGACAGAGGAAGA 0: 227
1: 20685
2: 124731
3: 218576
4: 194428
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982186684 Original CRISPR TCTTCCTCTGTCGCCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr