ID: 982186685

View in Genome Browser
Species Human (GRCh38)
Location 4:152809024-152809046
Sequence CGGGTCTTCCTCTGTCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204388
Summary {0: 1, 1: 42, 2: 2108, 3: 38322, 4: 163915}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982186685_982186689 24 Left 982186685 4:152809024-152809046 CCTGGGCGACAGAGGAAGACCCG 0: 1
1: 42
2: 2108
3: 38322
4: 163915
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
982186685_982186688 -2 Left 982186685 4:152809024-152809046 CCTGGGCGACAGAGGAAGACCCG 0: 1
1: 42
2: 2108
3: 38322
4: 163915
Right 982186688 4:152809045-152809067 CGTCTCAAAAAAAAAATAAGTGG 0: 1
1: 89
2: 863
3: 2801
4: 4095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982186685 Original CRISPR CGGGTCTTCCTCTGTCGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr