ID: 982186686

View in Genome Browser
Species Human (GRCh38)
Location 4:152809043-152809065
Sequence ACTTATTTTTTTTTTGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59590
Summary {0: 6, 1: 265, 2: 2697, 3: 22228, 4: 34394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982186686_982186690 23 Left 982186686 4:152809043-152809065 CCCGTCTCAAAAAAAAAATAAGT 0: 6
1: 265
2: 2697
3: 22228
4: 34394
Right 982186690 4:152809089-152809111 ACAGGTCCTTAAATAACAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 115
982186686_982186689 5 Left 982186686 4:152809043-152809065 CCCGTCTCAAAAAAAAAATAAGT 0: 6
1: 265
2: 2697
3: 22228
4: 34394
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982186686 Original CRISPR ACTTATTTTTTTTTTGAGAC GGG (reversed) Intronic
Too many off-targets to display for this crispr