ID: 982186687

View in Genome Browser
Species Human (GRCh38)
Location 4:152809044-152809066
Sequence CACTTATTTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156340
Summary {0: 2, 1: 253, 2: 2946, 3: 24127, 4: 129012}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982186687_982186689 4 Left 982186687 4:152809044-152809066 CCGTCTCAAAAAAAAAATAAGTG 0: 2
1: 253
2: 2946
3: 24127
4: 129012
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
982186687_982186690 22 Left 982186687 4:152809044-152809066 CCGTCTCAAAAAAAAAATAAGTG 0: 2
1: 253
2: 2946
3: 24127
4: 129012
Right 982186690 4:152809089-152809111 ACAGGTCCTTAAATAACAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982186687 Original CRISPR CACTTATTTTTTTTTTGAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr