ID: 982186689

View in Genome Browser
Species Human (GRCh38)
Location 4:152809071-152809093
Sequence GTGTTGTAGCATGTAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982186684_982186689 28 Left 982186684 4:152809020-152809042 CCAGCCTGGGCGACAGAGGAAGA 0: 227
1: 20685
2: 124731
3: 218576
4: 194428
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
982186685_982186689 24 Left 982186685 4:152809024-152809046 CCTGGGCGACAGAGGAAGACCCG 0: 1
1: 42
2: 2108
3: 38322
4: 163915
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
982186687_982186689 4 Left 982186687 4:152809044-152809066 CCGTCTCAAAAAAAAAATAAGTG 0: 2
1: 253
2: 2946
3: 24127
4: 129012
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
982186686_982186689 5 Left 982186686 4:152809043-152809065 CCCGTCTCAAAAAAAAAATAAGT 0: 6
1: 265
2: 2697
3: 22228
4: 34394
Right 982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982186689 Original CRISPR GTGTTGTAGCATGTAAACAC AGG Intronic
904743953 1:32699618-32699640 GTGTTGTAGCAAGTTAACTGTGG - Intronic
904792057 1:33030091-33030113 GTGGTGCAGGACGTAAACACAGG - Intronic
914677261 1:149914654-149914676 TTGTTGAAGCCTGTAAACATGGG - Intronic
918409736 1:184245894-184245916 GTGTTGTGGGATGTGAACATGGG - Intergenic
920632467 1:207665944-207665966 GTGTTGGACCATGTATACATGGG + Intronic
921187397 1:212682452-212682474 GTGTGGTAGAATGCAAACAATGG + Intergenic
923305246 1:232682398-232682420 GTGCTGTAGGTGGTAAACACAGG + Intergenic
1064357296 10:14631423-14631445 GTGCTGTAGAATTTATACACTGG - Intronic
1066099147 10:32102013-32102035 CTGTTGTTGCATGTGACCACTGG - Intergenic
1068134307 10:52936540-52936562 GAGTTGTTCCATGGAAACACAGG + Intergenic
1069077980 10:64058214-64058236 TAGTTGTGGTATGTAAACACTGG - Intergenic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1074518177 10:114191239-114191261 GTTTTGCAGCATGTTAACATGGG - Intronic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1080631914 11:34085462-34085484 TTATTTTAGGATGTAAACACAGG + Intronic
1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG + Intronic
1084839538 11:71833811-71833833 GTAATGTAGAATTTAAACACAGG + Intronic
1087232997 11:95686917-95686939 TTGTTGTCTCATGTAAAAACTGG - Intergenic
1087463593 11:98475983-98476005 GTTTTCTACCAAGTAAACACAGG + Intergenic
1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG + Intronic
1091115742 11:133011492-133011514 GTTTTATAGCATGTCAACTCTGG - Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1100413487 12:94346791-94346813 GTGTTGTGGTGTGAAAACACAGG + Intronic
1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG + Intronic
1117484047 14:56175970-56175992 GAGCTGTAAAATGTAAACACAGG - Intronic
1118517341 14:66544975-66544997 GTGTAGTAGGAGGTAGACACAGG - Intronic
1120602852 14:86533384-86533406 TTCTTGCAGCATGTACACACAGG + Intergenic
1124820068 15:33035965-33035987 GTGTGCTAACATGCAAACACAGG - Intronic
1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG + Intergenic
1138285826 16:55809620-55809642 GTGCAGTAGCATGCAAGCACAGG - Intronic
1138942987 16:61812844-61812866 GTGATATAGCACGTAAACGCAGG - Intronic
1146089008 17:29857417-29857439 GTGTTGTAGAAGGGAAACTCTGG - Intronic
1149797946 17:59538715-59538737 GTTATGTAACATGTTAACACTGG - Intergenic
1153328952 18:3852588-3852610 ATGTTGGATCATTTAAACACTGG - Intronic
1158011725 18:52736308-52736330 GTGTTGTAGCTTACAAACACTGG - Intronic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1161235064 19:3193573-3193595 GTGATGTAGCAGGTCCACACGGG - Intronic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG + Intronic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
926417702 2:12666131-12666153 GTTTTGTAACATGTTACCACTGG - Intergenic
930440669 2:51401621-51401643 GTGTTGTAGCATGGAGATAGAGG - Intergenic
934583386 2:95466004-95466026 GTGTTATAGCTCATAAACACGGG - Intergenic
934596064 2:95610710-95610732 GTGTTATAGCTCATAAACACGGG + Intergenic
934786711 2:97014768-97014790 GTGTTATAGCTCATAAACACGGG - Intronic
934991676 2:98925976-98925998 TTTTTGTAGCATATAAATACTGG - Intronic
935009703 2:99121986-99122008 GTGTTGGAGCATTTAGATACAGG - Intronic
938656528 2:133440387-133440409 CTGTTGTTGAATGAAAACACTGG + Intronic
940467499 2:154050370-154050392 GTGATGTAGCATGAGAGCACAGG - Intronic
942153623 2:173104616-173104638 GTGATGCAGCATGTTAACATGGG + Intronic
946627093 2:221624797-221624819 GTGTTCTGGCAGGAAAACACAGG - Intergenic
947304460 2:228728404-228728426 GTGTTCTATCCTGTAAAGACAGG + Intergenic
948555387 2:238806557-238806579 GTGTTGAAACCTGTAAAAACTGG - Intergenic
1169855795 20:10101275-10101297 GTGTTGTAAGATGTCACCACTGG + Intergenic
1170007594 20:11686253-11686275 GGGTTGGAGGATGTAAACACAGG - Intergenic
1174485755 20:50860178-50860200 GTTTTGAAGCATGTTACCACTGG - Intronic
951590762 3:24261895-24261917 GTCTTGTAGCTTGTAAAGGCTGG - Intronic
954767727 3:52935288-52935310 GAGTTGTAGCTTGTAAATCCTGG - Intronic
957993446 3:87656182-87656204 GTGTCTTAGCATTTAAACAAAGG + Intergenic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
964808699 3:160639496-160639518 GTCTTGGAGCCTTTAAACACAGG + Intergenic
965307753 3:167088312-167088334 TTGTTTTAGCATCTAAACATGGG + Intergenic
966186296 3:177229893-177229915 ATGTGGTCACATGTAAACACAGG - Intergenic
967681442 3:192368742-192368764 TTGTTGTAGCATGAAAGCAGAGG - Intronic
969780625 4:9399815-9399837 GTAATGTAGAATTTAAACACAGG + Intergenic
975383559 4:73729546-73729568 CTGTTGTTGGATTTAAACACTGG - Intergenic
977598901 4:98914830-98914852 CTGTTGTAGGATGTTGACACTGG + Intronic
978749368 4:112230253-112230275 GTTTTGTAACATGTCACCACTGG - Intergenic
980692684 4:136316501-136316523 GTGGTTTATCATGTAAACAAGGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561860 4:156937785-156937807 GTATTGTATTGTGTAAACACAGG - Intronic
989136598 5:38162054-38162076 GTGTTGTTGAATGAAAACAAAGG - Intergenic
990147147 5:52775211-52775233 GTTTGGTATCATGTAAACATGGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992885398 5:81153972-81153994 GTGTTTTATAATGAAAACACAGG + Intronic
993130027 5:83884900-83884922 CTGTAGTAGAATGTAAACTCAGG - Intergenic
993359795 5:86960365-86960387 GTGTTGTAGGTTATATACACAGG + Intergenic
995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG + Intronic
998903965 5:146883730-146883752 ATGTTGTAGCATGCACAAACAGG - Intronic
999711158 5:154319790-154319812 GTGTTTTAGGATCTCAACACTGG - Intronic
1006249227 6:32766399-32766421 GTGCAGTTGAATGTAAACACAGG + Intergenic
1008602863 6:53112666-53112688 ATGTGGTAGAAAGTAAACACAGG - Intergenic
1012523358 6:100147276-100147298 GAGTTTTAGCATGTAATCCCTGG + Intergenic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1016787971 6:148034154-148034176 GTGTTGTAAGATGTTACCACTGG + Intergenic
1018860252 6:167706099-167706121 GTGTAATAGCATGTAAATATTGG - Intergenic
1020805784 7:12789053-12789075 GTTATGTAACATGTTAACACTGG + Intergenic
1023961597 7:44931848-44931870 GTGTTGTAAAAAGTAAACAGTGG + Intergenic
1024965061 7:55017409-55017431 GTGTTGTGACTTGTACACACAGG + Intergenic
1027147360 7:75705330-75705352 ATGTTGTAGCATGTAACAGCAGG + Intronic
1027380276 7:77600981-77601003 GTATTGTTGCATTAAAACACAGG + Intronic
1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG + Intronic
1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG + Intergenic
1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG + Intronic
1036343463 8:7938144-7938166 GTAATGTAGAATTTAAACACAGG - Intronic
1036838804 8:12098908-12098930 GTCTTGTAGAATTTAAACACAGG - Intergenic
1036860592 8:12345151-12345173 GTCTTGTAGAATTTAAACACAGG - Intergenic
1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG + Intronic
1046073640 8:109289273-109289295 ATGTTTTAGCATGAAAAGACTGG - Intronic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1047457449 8:125028974-125028996 GTATTGAATCATGTAAACAGAGG - Intronic
1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG + Intronic
1050701954 9:8349974-8349996 GTCTTTCAGCTTGTAAACACTGG - Intronic
1186871640 X:13779904-13779926 ATGTTGTAGAACATAAACACGGG + Exonic
1191755159 X:64584914-64584936 GTGTTCTTACATGAAAACACAGG - Intergenic
1193260686 X:79403512-79403534 GTGTTGTAGCCCGCAAACAGTGG - Intergenic
1194324055 X:92489101-92489123 GACTTCTAGCCTGTAAACACAGG + Intronic
1200632158 Y:5602194-5602216 GACTTCTAGCCTGTAAACACAGG + Intronic