ID: 982189039

View in Genome Browser
Species Human (GRCh38)
Location 4:152834782-152834804
Sequence CCACTGCCTAGGAGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 16, 3: 119, 4: 373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982189039_982189046 -1 Left 982189039 4:152834782-152834804 CCCACAGCTCTCCTAGGCAGTGG 0: 1
1: 0
2: 16
3: 119
4: 373
Right 982189046 4:152834804-152834826 GCCCAGTAGGGACTCTGTGTGGG 0: 24
1: 631
2: 1491
3: 1673
4: 1407
982189039_982189048 0 Left 982189039 4:152834782-152834804 CCCACAGCTCTCCTAGGCAGTGG 0: 1
1: 0
2: 16
3: 119
4: 373
Right 982189048 4:152834805-152834827 CCCAGTAGGGACTCTGTGTGGGG 0: 547
1: 1296
2: 1585
3: 1244
4: 1022
982189039_982189045 -2 Left 982189039 4:152834782-152834804 CCCACAGCTCTCCTAGGCAGTGG 0: 1
1: 0
2: 16
3: 119
4: 373
Right 982189045 4:152834803-152834825 GGCCCAGTAGGGACTCTGTGTGG 0: 13
1: 584
2: 1377
3: 1663
4: 1501
982189039_982189050 1 Left 982189039 4:152834782-152834804 CCCACAGCTCTCCTAGGCAGTGG 0: 1
1: 0
2: 16
3: 119
4: 373
Right 982189050 4:152834806-152834828 CCAGTAGGGACTCTGTGTGGGGG 0: 490
1: 1183
2: 1384
3: 1169
4: 903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982189039 Original CRISPR CCACTGCCTAGGAGAGCTGT GGG (reversed) Intronic
900288575 1:1914222-1914244 CCACTGGCTGTGAGAGTTGTTGG + Intergenic
900738290 1:4314105-4314127 GCACTGCCTAGTGGATCTGTAGG - Intergenic
900822742 1:4901783-4901805 GCACTCCCTAGTGGAGCTGTGGG - Intergenic
901789989 1:11648995-11649017 CCCCAGCCCAGGAGCGCTGTGGG + Intronic
902095237 1:13938683-13938705 GAACTGCCTAGTGGAGCTGTGGG + Intergenic
904272891 1:29362150-29362172 CGACTGGCAAGGAGTGCTGTGGG - Intergenic
905496238 1:38390110-38390132 GCACTACCTAGTGGAGCTGTGGG - Intergenic
906247602 1:44288061-44288083 CCACTGCCTAGGAAGGGTCTAGG + Intronic
906763770 1:48407409-48407431 GCTCTGCCTAGCAAAGCTGTGGG + Intronic
907675580 1:56515042-56515064 CCACTGCCAAGAATAGCTGAGGG - Intronic
908177007 1:61565817-61565839 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
908960937 1:69696011-69696033 GCACTGCCTAGTGGAGCTGCGGG + Intronic
909167383 1:72246712-72246734 CCACTACCTAGTGGAGCTGTAGG - Intronic
909699885 1:78511166-78511188 GCATTGCCTAGTAGAGCTGTGGG - Intronic
909700278 1:78514122-78514144 GCACTGCCTAGTGGAACTGTGGG + Intronic
909861138 1:80607165-80607187 CCCCAGCCTAGAAGAGCTGCAGG + Intergenic
910423882 1:87100127-87100149 GAACTGCCTAGTGGAGCTGTGGG - Intronic
910512413 1:88021865-88021887 GCACTTCCTAGTGGAGCTGTGGG - Intergenic
911489277 1:98542366-98542388 CCACTGCCTAGAAGAGTTCCTGG - Intergenic
911512781 1:98827833-98827855 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
911644112 1:100320459-100320481 GCACTGACTAGTGGAGCTGTGGG + Intergenic
912073182 1:105839603-105839625 GCACTGCCTATTGGAGCTGTGGG + Intergenic
912615637 1:111097140-111097162 GCACTGCCTAGTGAAGCTGTGGG - Intergenic
913352348 1:117875520-117875542 GCACTGCCTAGTGGAGCTGTGGG + Intronic
913402250 1:118449089-118449111 GCACTACCTAGTGGAGCTGTGGG + Intergenic
913581407 1:120231358-120231380 GCACTAACTAGGTGAGCTGTGGG - Intergenic
913626769 1:120667030-120667052 GCACTAACTAGGTGAGCTGTGGG + Intergenic
914338769 1:146740262-146740284 TCAAAGCCTAGGAGAGCAGTGGG + Intergenic
914563339 1:148842804-148842826 GCACTAACTAGGTGAGCTGTGGG - Intronic
914609488 1:149287419-149287441 GCACTAACTAGGTGAGCTGTGGG + Intergenic
914954399 1:152147859-152147881 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
915050243 1:153062565-153062587 CCACTGCCTTGGAGATCAGGAGG - Intergenic
915719165 1:157971500-157971522 GCACTGGCTAGTGGAGCTGTGGG - Intergenic
915855663 1:159383842-159383864 GCACTGCCTAGTGGAGGTGTGGG + Intergenic
916400994 1:164448474-164448496 GCACTGCCTAGTGGAGCTATGGG - Intergenic
916727255 1:167534069-167534091 ACGCTGCCTAGGATAGATGTTGG - Intronic
917114700 1:171591143-171591165 CCCCTGCAGAAGAGAGCTGTGGG + Intronic
917235597 1:172888615-172888637 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
919806756 1:201385118-201385140 CCACTGCCCATGAGCTCTGTGGG + Intronic
919920662 1:202164737-202164759 GCGCTGCCTGGGACAGCTGTAGG + Intergenic
920325893 1:205163554-205163576 CCACTGCCTGTGGGAGATGTTGG - Intronic
921550670 1:216531882-216531904 TCACAGCCTAGGAGAGAGGTGGG - Intronic
922215529 1:223516650-223516672 CCAGAGTCCAGGAGAGCTGTGGG - Intergenic
1062868344 10:876646-876668 CATCAGCCTGGGAGAGCTGTGGG - Intronic
1064672599 10:17731834-17731856 CCACTGCCCAGGAGAGGCCTTGG + Intergenic
1066183170 10:32982881-32982903 CCCCTGTCTAGAAGAGCTCTTGG - Intronic
1067293014 10:44958210-44958232 CAACTGCCCAGGAGTGCTGGGGG + Intergenic
1067783075 10:49223153-49223175 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1068262878 10:54606063-54606085 TCACTGTCTATGAGAGCTATTGG - Intronic
1068369146 10:56091331-56091353 GTACTGCCTAGTGGAGCTGTTGG + Intergenic
1069290452 10:66772497-66772519 ACACTGCGAAGGAGAGCTGAAGG + Intronic
1069381025 10:67843349-67843371 GCACTGCCTAGTGAAGCTGTGGG + Intergenic
1069642735 10:69966420-69966442 CCACTGGCTGGGGGAGCTGCAGG - Intergenic
1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG + Intronic
1070083013 10:73207182-73207204 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1070245889 10:74730874-74730896 GCACTGCATAGTAGAGCTGTGGG + Intergenic
1071666966 10:87568026-87568048 GCACTGACTAGTGGAGCTGTGGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1071934144 10:90508418-90508440 GCACTGCCCAGTGGAGCTGTGGG - Intergenic
1072155829 10:92722924-92722946 CAACTGACTAGGAGAGTTGATGG + Intergenic
1072202478 10:93173205-93173227 CCACTCTGTAGGAGAGCTTTCGG + Intergenic
1072224613 10:93357016-93357038 CCTCTGCCTTGCAGAGCTGATGG + Intronic
1072280637 10:93862525-93862547 GCACTGCCTAGTGGAACTGTGGG + Intergenic
1072947735 10:99825719-99825741 CCACTGCCTGAGAGGACTGTAGG - Intronic
1073396637 10:103223510-103223532 CCTCCACCTAGAAGAGCTGTAGG - Intergenic
1076878098 10:133226652-133226674 CCACGGCCTGGGAGTGCTGGCGG - Intergenic
1077096396 11:800906-800928 CCAGTACCTGGGAGAGCTGGGGG + Exonic
1077638546 11:3860548-3860570 ACCCTGCCTGGGAGAGCTGGGGG + Intronic
1078363998 11:10691936-10691958 CCCCTGCTTTGTAGAGCTGTGGG + Intronic
1079721909 11:23825985-23826007 GAACTGCCTAGTAGAGCTGTGGG - Intergenic
1079772082 11:24474959-24474981 GCACTGCCTAGTGGAGTTGTGGG - Intergenic
1079903967 11:26222477-26222499 GCACTGCCTAGCAGAGCTGTGGG - Intergenic
1079957047 11:26878905-26878927 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
1080306673 11:30844281-30844303 GCACTGCCTAGTGGAGCTGTGGG - Intronic
1080521995 11:33075708-33075730 CTACTGCCTATTAGTGCTGTGGG - Intronic
1081628609 11:44671788-44671810 ACACTGCCTAGTGGAGCTGTGGG + Intergenic
1083224186 11:61274208-61274230 CCACTGCCTAGGTGGGTTGATGG - Intronic
1084925327 11:72506838-72506860 GCACTGCCTAGTGGAGCTATGGG - Intergenic
1085418421 11:76335305-76335327 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1085851414 11:80124586-80124608 GTACTGCCTAGTGGAGCTGTGGG + Intergenic
1087462487 11:98462885-98462907 GCAATGCCCAGCAGAGCTGTGGG + Intergenic
1087462510 11:98463011-98463033 CAACAGCCTAGCAGAGCTGCAGG + Intergenic
1087496258 11:98894075-98894097 GCACGGCCTAGTGGAGCTGTGGG - Intergenic
1087781133 11:102302518-102302540 ACACTGCCTAGTGGAGCTGTAGG - Intergenic
1089929773 11:122298385-122298407 GCACAGCCTAGTGGAGCTGTGGG - Intergenic
1090728771 11:129551666-129551688 GCACTGCCTAGTGGAGCTGTAGG + Intergenic
1091485352 12:881446-881468 ACACTGCCTAGCAGATATGTTGG + Intronic
1091958037 12:4664642-4664664 CCTCTGCCCAGGAGAGCTATTGG + Intronic
1092181637 12:6450746-6450768 CCACTGTTTAGGAGAGGAGTTGG + Intronic
1093371932 12:18376117-18376139 GCACTGCATAGTAGAGATGTGGG + Intronic
1093537322 12:20237632-20237654 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1093750054 12:22788021-22788043 CTACGGCCTAGCAGAGCTTTTGG - Intergenic
1093988952 12:25569001-25569023 GCACTGCCTGGTGGAGCTGTGGG + Intronic
1095580153 12:43788304-43788326 ACACTGCCTAGTAGAGCTATGGG + Intronic
1095838805 12:46669509-46669531 GCACTTCCTAGTAGAGCTCTGGG - Intergenic
1096714517 12:53483033-53483055 CCAGCGCCAAGGGGAGCTGTGGG - Exonic
1096829223 12:54301322-54301344 CCTGTCCCTAGGAGAGCCGTGGG - Intronic
1096875696 12:54628706-54628728 GTAATGCCTAGTAGAGCTGTGGG + Intergenic
1099475577 12:83104269-83104291 GCACTGCCTAGTGGAGCTATGGG - Intronic
1099890823 12:88586519-88586541 TCACTGCCTAGTGGAGCTGTGGG - Intergenic
1099984707 12:89649160-89649182 GCACTGCTTAGTGGAGCTGTGGG + Intronic
1100607380 12:96162819-96162841 GGACTTCCTAGGAGGGCTGTTGG - Intergenic
1101523131 12:105503375-105503397 GCTCTGCCAAAGAGAGCTGTGGG + Intergenic
1102166583 12:110811642-110811664 CCAATGCCAGGCAGAGCTGTTGG + Intergenic
1103575070 12:121871516-121871538 CCCTTGCTTGGGAGAGCTGTGGG - Intergenic
1106383692 13:29264427-29264449 GCACTGCCTGGGGGAGCTATGGG - Intronic
1107119510 13:36781341-36781363 ATACTGCCTAGTAGAGCTGTGGG - Intergenic
1108222553 13:48251482-48251504 CCAGTGCCTAGCACAGCTCTTGG + Intronic
1108681248 13:52782381-52782403 CCACTGCCATGAAGGGCTGTTGG + Intergenic
1108725366 13:53175012-53175034 CCACTGCCTAAGAGATCTGATGG + Intergenic
1108832577 13:54498378-54498400 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1108951409 13:56099108-56099130 GCACTGTCTAGTGGAGCTGTGGG - Intergenic
1109434653 13:62283723-62283745 GCATTGCCTAGTAGAGCTGTGGG - Intergenic
1109513089 13:63404817-63404839 CCCCTGCCCAAGAGATCTGTTGG - Intergenic
1109602514 13:64650477-64650499 GCAATGCCTAGTGGAGCTGTGGG + Intergenic
1109603097 13:64658275-64658297 GCATTGCCTAGTGGAGCTGTAGG + Intergenic
1109735775 13:66482619-66482641 GCACATCCTGGGAGAGCTGTTGG + Intronic
1110130356 13:72001425-72001447 CCACTGCCTAGGAGTTCCCTGGG - Intergenic
1110345643 13:74444538-74444560 CCACAGTCAAGGAGAGCTGAAGG + Intergenic
1110566022 13:76958369-76958391 CCATGGTCTAGGAGATCTGTTGG - Exonic
1111282982 13:86051430-86051452 CCACTTCCTTGGTGACCTGTAGG + Intergenic
1111463394 13:88575890-88575912 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1112568185 13:100569164-100569186 GCACTGCCTAGTAGAGCTGTGGG - Intronic
1113269318 13:108655545-108655567 GCACTGCCTAGTGGAGCTTTGGG + Intronic
1114140275 14:19901540-19901562 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1114258030 14:21018869-21018891 CCTCTGCCTAGGAGTGCAGCTGG + Intronic
1114383394 14:22232271-22232293 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
1114431584 14:22666219-22666241 GCACTACCTAGCGGAGCTGTGGG - Intergenic
1114688243 14:24555375-24555397 GCACTGCCTAGTGGAGCTGGGGG + Intergenic
1116103371 14:40469249-40469271 CCACTGGTTAGGAGGCCTGTAGG - Intergenic
1116199280 14:41770803-41770825 ACACTGTCTAGTGGAGCTGTGGG - Intronic
1116527114 14:45918698-45918720 ACAATGCCTAGTGGAGCTGTGGG + Intergenic
1116756761 14:48957971-48957993 CCTCAGCCTAGAAGAGCTGCAGG + Intergenic
1117984520 14:61374372-61374394 GCACTACCTAGTGGAGCTGTGGG - Intronic
1118067408 14:62206997-62207019 GCACAGCCTAGGAGAGGTGCAGG - Intergenic
1118404766 14:65412562-65412584 CCACCGCCTAGCAGAGCCGCGGG - Intronic
1118476896 14:66125968-66125990 AGACTGCCTTGGAGAGCAGTGGG + Intergenic
1120072899 14:80123344-80123366 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1120164248 14:81178862-81178884 TCACTGCCTGGGAGAACTGCAGG - Exonic
1120405028 14:84083956-84083978 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1121457649 14:94048870-94048892 TTACTGCCTAGGGAAGCTGTAGG - Exonic
1123064646 14:105611351-105611373 GCACTGCCTAGCGGAGCTGTGGG + Intergenic
1123073950 14:105656992-105657014 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1123087950 14:105726575-105726597 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1123093908 14:105755948-105755970 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1124717007 15:32072988-32073010 TCACTGCCTACTGGAGCTGTAGG + Intronic
1124888565 15:33710530-33710552 GTACTGCCTAGTGGAGCTGTGGG - Intronic
1125407633 15:39370011-39370033 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1125682267 15:41538994-41539016 CCAGGGGCTAGGAGAGCTGGAGG + Intronic
1128725275 15:69983365-69983387 CCCTTGCCTAGCAGAGCTCTGGG + Intergenic
1129674513 15:77625124-77625146 CCCCCGCCTGGGAGAGCTATAGG + Intronic
1129753621 15:78082949-78082971 CCACTGGCCTGCAGAGCTGTGGG - Intronic
1130385353 15:83406690-83406712 CCAGTGGCTAGGAGTGCTGCTGG + Intergenic
1131470082 15:92689099-92689121 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1131523391 15:93133815-93133837 TCCCTGCCTAGGAAAGCTGTAGG - Intergenic
1131611067 15:93964547-93964569 TCACTGCCTTGGAGAGATCTGGG + Intergenic
1132033189 15:98456042-98456064 CCACAGCCTAGGAGTGCAGCAGG + Intronic
1132271705 15:100532129-100532151 CCCTTGGCTAGGAGAGCTTTTGG - Intronic
1132302977 15:100787874-100787896 CCACTGACTAGTAGAGTGGTAGG + Intergenic
1132379629 15:101357745-101357767 CCAGTGCCTTGGTGAGCTCTGGG + Intronic
1133257253 16:4524667-4524689 CCAGTGCCTAGGACAGCCATGGG + Intronic
1133699422 16:8295217-8295239 CCACTTCCTAGGTGAGGTATTGG + Intergenic
1134077260 16:11300517-11300539 CCATTGCCTAATAGGGCTGTTGG + Intronic
1134608095 16:15586906-15586928 CTTCTGCCTTGGAGAGCTCTTGG - Exonic
1135156814 16:20059690-20059712 CCACTGCCTAGAAGAGTGCTTGG + Intronic
1136072866 16:27798785-27798807 CCACTGCCTTGGACAGAAGTGGG + Intronic
1136183335 16:28570065-28570087 GCATTGCCTAGCAGAGCTATGGG + Intronic
1138800083 16:60016527-60016549 TCACTGCCTAGTGGAGCTATCGG - Intergenic
1138970149 16:62133877-62133899 GCACTGCCTAGTGGAGCTATGGG - Intergenic
1139041352 16:63002324-63002346 GCACTGCCTAGTGGATCTGTGGG + Intergenic
1139579326 16:67862963-67862985 CCACTGCCTAAGAGCTCTGAGGG - Intronic
1139589051 16:67923142-67923164 CCACTGCCTAGGAGTGGCTTTGG + Intronic
1139995508 16:70977092-70977114 TCAAAGCCTAGGAGAGCAGTGGG - Intronic
1140830929 16:78750215-78750237 CCACTGCCCAGGTCAGCTGGTGG + Intronic
1144118618 17:12127157-12127179 CCTCTGCAGAGGTGAGCTGTTGG - Intronic
1144579436 17:16450155-16450177 CTACTGCCTTGGGGTGCTGTGGG - Intronic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1148762559 17:50014521-50014543 GCATTGCCTAGTGGAGCTGTGGG - Intergenic
1149025120 17:52018217-52018239 ACACTGCCTAGTGGAGCTGTAGG + Intronic
1149028993 17:52062845-52062867 GCAGTGCCCAGGGGAGCTGTGGG + Intronic
1150969459 17:70010877-70010899 GCACTACCTAGTAGAGCTGTGGG + Intergenic
1150987435 17:70214047-70214069 GTACTGCCTAGTGGAGCTGTGGG + Intergenic
1151681800 17:75626323-75626345 CCACTGCTCCGGAGTGCTGTGGG + Intergenic
1152261446 17:79269473-79269495 CTCCTGCCTCTGAGAGCTGTGGG + Intronic
1153276648 18:3374190-3374212 TCACTGCCCAGCTGAGCTGTTGG - Intergenic
1154513570 18:15136001-15136023 GCACTGCCTGGTGGAGCTGTGGG - Intergenic
1157010493 18:43642843-43642865 GCACTGCCGGGGAGAGCTGCTGG + Intergenic
1158374500 18:56847980-56848002 GCACTGCCTAGTGGAGCTGTAGG + Intronic
1159265311 18:66072258-66072280 GCACTGCCTAGTGGAGCTATGGG + Intergenic
1159305630 18:66638654-66638676 CAGCTGCTTAGGGGAGCTGTGGG - Intergenic
1159540622 18:69770189-69770211 CCCCTACCTTGGAGAGTTGTTGG - Intronic
1159587344 18:70293132-70293154 CCACTGAGTAGGAGGGGTGTGGG + Intronic
1159759575 18:72408084-72408106 TAACTGCCTAGTGGAGCTGTGGG + Intergenic
1159963257 18:74572257-74572279 CTGATGCCTAGAAGAGCTGTAGG - Intronic
1161062415 19:2221884-2221906 CCACCCCCTAGGAGCTCTGTGGG - Intronic
1162246871 19:9408355-9408377 CCACTCTCTAGGAGAGCTGGTGG - Intergenic
1163056771 19:14725906-14725928 GCACTGCCTAGTGGAGCTGGAGG - Intronic
1164779042 19:30878003-30878025 GCACTGTCTAGGATAGTTGTTGG + Intergenic
1165152469 19:33769151-33769173 CCACAGCCTCGGAGGGCAGTGGG - Intronic
1165159816 19:33809485-33809507 CCCCTGCATGGGAGAGCTGGTGG + Intronic
1166164918 19:40980662-40980684 GCACTGCTTAGTGGAGCTGTGGG - Intergenic
1166518703 19:43465274-43465296 CCACGGACAAGGGGAGCTGTGGG - Intronic
1166671238 19:44710660-44710682 CCACTCCCTCGCTGAGCTGTTGG + Exonic
1167749627 19:51371904-51371926 CCACTGCCCTGGGGAGCTTTGGG - Intronic
925357181 2:3250091-3250113 ACACTGCCTAGTGGAGCTGTAGG + Intronic
925951935 2:8922855-8922877 CCTCAGGCTAGGAGAGCTGGAGG + Intronic
926161495 2:10493248-10493270 CCACTGCCCAGGAGAGCTACTGG + Intergenic
926425919 2:12738562-12738584 GCACTGCCTCAGAGAGTTGTAGG - Intronic
926563649 2:14445448-14445470 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
926750507 2:16195341-16195363 CCACTGCCTAGCACAACTTTTGG + Intergenic
927436814 2:23073677-23073699 CCACAGGCTAGGAGAGCAGGGGG - Intergenic
928235713 2:29537636-29537658 GCACTTCCTAGTGGAGCTGTGGG + Intronic
930170535 2:48246949-48246971 ACACTGCCTAGTGGAGCTGTGGG + Intergenic
930872941 2:56185355-56185377 CCACTGCCAGGGAGAGCGGCTGG + Intronic
930931276 2:56886336-56886358 GCACTGCCTAGTGGAACTGTGGG + Intergenic
930952132 2:57155956-57155978 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
931641334 2:64383261-64383283 CCTCTGCCTAGGAGTTCTTTGGG - Intergenic
931849480 2:66237901-66237923 CCACAGCCTAGCTGAGCTGGGGG - Intergenic
932659384 2:73639302-73639324 ACATTGCCTAGTGGAGCTGTGGG + Intergenic
932665948 2:73698975-73698997 ACATTGCCTAGTGGAGCTGTGGG + Intergenic
933439780 2:82297658-82297680 ACACTGCCTAGTAGAGCTGTGGG - Intergenic
934015879 2:87881294-87881316 GTACTGCTTAGTAGAGCTGTGGG - Intergenic
934536568 2:95139269-95139291 GCACTGCCTAGTGGAGCTGTGGG + Intronic
934891899 2:98078034-98078056 GAACTGCCTAGTGGAGCTGTGGG - Intergenic
935323119 2:101907553-101907575 CCCCTGCTTAAGAGATCTGTGGG - Intergenic
936734727 2:115427238-115427260 ACATTGCCTAGTGGAGCTGTGGG - Intronic
937117781 2:119421110-119421132 TCACTGCCTAGTGGAGTTGTGGG - Intergenic
937323483 2:120974718-120974740 CATCTGACAAGGAGAGCTGTGGG + Intronic
937327919 2:121003147-121003169 GTACTGCCTAGTGGAGCTGTGGG + Intergenic
937726762 2:125175969-125175991 GCACTGCCTAGGGGAGCTGTGGG + Intergenic
937827947 2:126388402-126388424 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
938130075 2:128707599-128707621 TCACTGCCTAGTGGAGCTGGGGG - Intergenic
938630225 2:133158839-133158861 CCAGTGCCCAGAAGAGCAGTAGG - Intronic
938974121 2:136459141-136459163 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
939241963 2:139572815-139572837 GCACTTCCTAGTGGAGCTGTGGG + Intergenic
939310421 2:140468477-140468499 GCAATGCCAAGCAGAGCTGTGGG + Intronic
940408821 2:153336223-153336245 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
942032684 2:171978532-171978554 TCACAGCCTAGGAGAGATTTGGG - Intronic
942063872 2:172252250-172252272 ACACTGCCTCTGAGAGCAGTGGG + Intergenic
942347462 2:175018209-175018231 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
944160300 2:196652661-196652683 GCACTGCTCAGGGGAGCTGTGGG - Intronic
944379553 2:199092311-199092333 CCCCAGCCTGGGAGAGCTATAGG - Intergenic
944514272 2:200496218-200496240 CCACTGCCTTAGAAAGCTGAAGG - Intronic
946853560 2:223930938-223930960 GCACTGCCTAGGTGACCTGTAGG + Intronic
947126503 2:226874249-226874271 CCATTACCTAGGAGGACTGTAGG + Intronic
947197566 2:227584018-227584040 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
948029367 2:234804388-234804410 CCAATGCCTAGAACAGCAGTAGG - Intergenic
948575991 2:238950032-238950054 CCACTGCCTGGAAGAGCAGAGGG + Intergenic
948669564 2:239559346-239559368 CCCCTGCCTAGGAGGGCAGTGGG - Intergenic
948721506 2:239903864-239903886 CCCCTGCATGGAAGAGCTGTGGG - Intronic
1169717909 20:8641515-8641537 CCATTACCTAGGAGTCCTGTGGG - Intronic
1169766448 20:9152718-9152740 GCACTGCCTAGTGGAGTTGTGGG + Intronic
1169855537 20:10098154-10098176 CCAATGCCTAGAAGAGTTTTGGG + Intergenic
1170318664 20:15069900-15069922 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1170479944 20:16755524-16755546 GCACTGCCTAGTGGAGCTGTGGG - Intronic
1173067720 20:39729042-39729064 GCACTGCCTGGTGGAGCTGTGGG + Intergenic
1173621353 20:44439274-44439296 CCACTGCCCAGGCCACCTGTGGG - Intergenic
1174393843 20:50234028-50234050 CGGCTGCCAAGGAGAGCTGGAGG + Intergenic
1174441707 20:50560871-50560893 CCACCTCCTAGGAAAGCAGTTGG + Intronic
1175315388 20:58043522-58043544 CCACTTCCTTTGACAGCTGTTGG + Intergenic
1175851043 20:62093123-62093145 CCCCTGCCTGGCAGAGCTGGTGG + Intergenic
1176925592 21:14745341-14745363 GCACAGCCTAGTGGAGCTGTGGG - Intergenic
1177187067 21:17808483-17808505 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1177206618 21:18017736-18017758 CCACTCCCTAGTGGAGCTGTGGG + Intronic
1177248812 21:18566597-18566619 CCACTGCCTGAGAGGACTGTAGG - Intergenic
1177952163 21:27552120-27552142 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1179126986 21:38599352-38599374 ACCCTGCCATGGAGAGCTGTGGG + Intronic
1179432656 21:41334725-41334747 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1180612822 22:17108860-17108882 GCACCGCGTAGGGGAGCTGTCGG + Exonic
1180857723 22:19058919-19058941 CCCCTGCCCAGGGGAGCTGCTGG + Intronic
1180889506 22:19276168-19276190 CCACCACCGAGGAGAGCTTTGGG + Intronic
1181358392 22:22316390-22316412 GCACTGCCTAGTGGAGGTGTGGG - Intergenic
1182348455 22:29683849-29683871 CCACTGCCTAGGCATGCTGGAGG - Intronic
1182866796 22:33611170-33611192 ACACTGCCTAGCAGAGCTGTGGG + Intronic
1183729625 22:39610739-39610761 GCACAGACTAGCAGAGCTGTGGG - Intronic
1184243054 22:43221418-43221440 CCCCACCCCAGGAGAGCTGTCGG - Intronic
1184338908 22:43874717-43874739 GCACTGCCTAGTGCAGCTGTAGG + Intergenic
1184800454 22:46755753-46755775 CCACTGCCTAGTGGAGCTGTGGG - Intergenic
1184974909 22:48054155-48054177 CCACTGCCCAGGAGCTCTGCTGG + Intergenic
949230402 3:1743884-1743906 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
950264409 3:11563556-11563578 CCTCTGCAGAGCAGAGCTGTGGG - Intronic
950578548 3:13847517-13847539 ACAGTGCCAAGGAAAGCTGTAGG - Intronic
951241173 3:20287818-20287840 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
952807945 3:37375087-37375109 GCACTGCCTAGTGGATCTGTGGG - Intergenic
953192533 3:40701202-40701224 GCACTGCTTAGTGGAGCTGTGGG + Intergenic
953359228 3:42280356-42280378 GCACTGCTTAGAGGAGCTGTGGG + Intergenic
953379349 3:42455221-42455243 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
953407601 3:42667195-42667217 CCCCTCCCAAGGAGATCTGTGGG + Intergenic
953972762 3:47359873-47359895 GCACTGCCTGGTGGAGCTGTTGG + Intergenic
956084862 3:65597946-65597968 CCCCTTCCTGGGAGAGCTGGGGG + Intronic
956238603 3:67104158-67104180 GCACTGTCTAGTAAAGCTGTGGG + Intergenic
957446982 3:80325928-80325950 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
957868073 3:86050463-86050485 GCACTGCCTAGTGGAGCTCTGGG - Intronic
957909965 3:86607898-86607920 GCACTGCCTAGTGGAGCTATGGG - Intergenic
958560466 3:95742623-95742645 GCACTGCCTAAAGGAGCTGTGGG - Intergenic
959228642 3:103618938-103618960 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
959873959 3:111360258-111360280 GCACTGCCTAGCAGAGTTGTGGG + Intronic
959935316 3:112022836-112022858 GCACTTCCTAGTGGAGCTGTGGG + Intergenic
961406754 3:126685106-126685128 GCACTGCCTGGTGGAGCTGTGGG + Intergenic
961586615 3:127933403-127933425 TCTCAGCCTAGGAGAACTGTAGG - Intronic
962297823 3:134208822-134208844 CCATTGCCTAGGGTTGCTGTAGG + Intronic
963297122 3:143558318-143558340 GCACTGCCTAGTGGAGCTGTAGG + Intronic
963640685 3:147858202-147858224 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
963982651 3:151557241-151557263 CCTCTTCATAGGAGAGCTGTAGG + Intergenic
964341946 3:155717324-155717346 GCACTGCCTAGTGGAACTGTGGG - Intronic
966164879 3:177006297-177006319 GTACTGCCTAGTGGAGCTGTGGG + Intergenic
966212746 3:177469946-177469968 CCACTGTCTATGAAAGCTCTGGG + Intergenic
967048035 3:185755448-185755470 GTACTGCCTAGTGGAGCTGTGGG + Intronic
967577228 3:191108044-191108066 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
967748288 3:193084053-193084075 GAACTGCCTAGTGGAGCTGTGGG + Intergenic
967883623 3:194318525-194318547 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
968354541 3:198094049-198094071 GTACTGCCTAGTGGAGCTGTGGG - Intergenic
968643628 4:1727708-1727730 CCACTTCCTTGATGAGCTGTTGG - Exonic
968964613 4:3763663-3763685 CCACTGCCCAGGAGGGCTGAAGG - Intergenic
968982332 4:3856997-3857019 AGCCTGCCTGGGAGAGCTGTGGG - Intergenic
970376399 4:15461753-15461775 TCACTTTCTAAGAGAGCTGTTGG - Intergenic
970583113 4:17491466-17491488 CCTCTGCCTGGGACAGCTGATGG + Intronic
971041411 4:22756508-22756530 CCACTGCCAAGGAAAGGGGTTGG + Intergenic
971546838 4:27896819-27896841 GCAATGCCTAGTGGAGCTGTGGG + Intergenic
971848127 4:31946533-31946555 GCACTGCCTAGTGGAGCTGTAGG + Intergenic
971933601 4:33118129-33118151 GCACTGCTTAGTGGAGCTGTGGG - Intergenic
971977534 4:33710138-33710160 CCACTGCCTAGTGGAGCTGTGGG - Intergenic
972674474 4:41246179-41246201 CCTCAGGCTAGGAGAGCTGAAGG - Intergenic
973580743 4:52341886-52341908 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
975506497 4:75144226-75144248 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
975609907 4:76193400-76193422 GCACTGCCTAGTGGAGCTGTGGG + Intronic
977651369 4:99473323-99473345 ACAATGCCTAGTGGAGCTGTGGG - Intergenic
977707333 4:100086503-100086525 GCACTGCCTAGTGGAGTTGTAGG - Intergenic
981278766 4:142932849-142932871 TCACTGCATGAGAGAGCTGTAGG - Intergenic
981335392 4:143563231-143563253 GCACTGCCTAGTGGAGCTGTAGG + Intergenic
981483342 4:145259861-145259883 GCACTGCCTAGCGGAGCTGTGGG - Intergenic
982189039 4:152834782-152834804 CCACTGCCTAGGAGAGCTGTGGG - Intronic
982207925 4:153011099-153011121 GCACTGCCTTGTGGAGCTGTGGG - Intergenic
982287029 4:153746469-153746491 CTCCAGCCTAGGAGAGCTATGGG - Intronic
982287034 4:153746506-153746528 CTCCAGCCTAGGAGAGCTATGGG - Intronic
982287039 4:153746543-153746565 CTCCAGCCTAGGAGAGCTATGGG - Intronic
982287049 4:153746617-153746639 CTCCAGCCTAGGAGAGCTATGGG - Intronic
982417819 4:155157538-155157560 TCACTGGCTAGGAAAGCTGTGGG + Intergenic
982566843 4:156996741-156996763 GCAATGCCTAGTAGAGCTGTGGG - Intergenic
982948862 4:161663707-161663729 CCACTGCCTAGTGGAGCTGTAGG - Intronic
983351511 4:166596710-166596732 GCACTGCCTAGTGGAACTGTGGG + Intergenic
983425150 4:167574592-167574614 CCAATGCCTAGGAAAGCTGTTGG - Intergenic
983959664 4:173736971-173736993 CCACAGCCTTGCAGAGCTGATGG - Intergenic
985259011 4:188097674-188097696 CCACTGGCTGGGAGGGCAGTGGG + Intronic
985809590 5:2073264-2073286 GAACTGCCTAGTGGAGCTGTGGG + Intergenic
986210581 5:5667714-5667736 CTTCTGCCTATGACAGCTGTAGG + Intergenic
986985916 5:13500942-13500964 GCACTGCCTAGTGGAGTTGTGGG + Intergenic
987154701 5:15077572-15077594 TCACTGCCTAGGAGAGTCTTGGG + Intergenic
988103192 5:26708488-26708510 ACACTACCTAGTGGAGCTGTGGG + Intergenic
988180596 5:27786538-27786560 CCTCTGCCGGGTAGAGCTGTGGG - Intergenic
988928068 5:36009105-36009127 GCACTGTCTAGTGGAGCTGTGGG - Intergenic
989726823 5:44597206-44597228 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
990520286 5:56573087-56573109 GTACTGCCTAGTGGAGCTGTGGG - Intronic
991202226 5:64007937-64007959 TCACTGTCTAGGAGAGGAGTAGG - Intergenic
991492450 5:67196222-67196244 CCTCAACCTAGGGGAGCTGTTGG - Intronic
991600703 5:68349009-68349031 ACACTGCCTAGTGGAGCTATGGG + Intergenic
992362409 5:76053856-76053878 CCACAGCCTATGAGATTTGTAGG - Intergenic
993068129 5:83126635-83126657 GCAATGCCTGGTAGAGCTGTGGG + Intronic
993198508 5:84782020-84782042 GCACTACCTAGTGGAGCTGTGGG - Intergenic
993390948 5:87319274-87319296 GCACTGCCTAATGGAGCTGTGGG - Intronic
993581011 5:89661095-89661117 CCTCTGCCTAGAAAAGCTATAGG + Intergenic
993781161 5:92066681-92066703 GCACTGCCTATTGGAGCTGTGGG + Intergenic
995572132 5:113491600-113491622 GCAATGCCTAGTGGAGCTGTGGG + Intergenic
995971196 5:117973572-117973594 GCAGTGCCTAGTGGAGCTGTGGG - Intergenic
996095687 5:119396458-119396480 CCACTGCTAGGGACAGCTGTGGG - Intronic
996284291 5:121770311-121770333 ACACTTCCTAGTGGAGCTGTGGG + Intergenic
996674510 5:126158487-126158509 GCACTGGCTAGTGGAGCTGTGGG + Intergenic
996701087 5:126450991-126451013 GCACTGCCTAGTGGAACTGTAGG + Intronic
997109395 5:131058340-131058362 CCCCAGACCAGGAGAGCTGTGGG - Intergenic
997575840 5:134976605-134976627 GCACTGCCTAGTGGAGCTCTGGG - Intronic
998576631 5:143324128-143324150 GCACTGCCCAGTGGAGCTGTGGG - Intronic
998953202 5:147412652-147412674 CACCTGCCTGGGAGAGCTGGGGG - Exonic
999986192 5:157007670-157007692 GCACTGCCTAGTGGAGTTGTTGG - Intergenic
1000262361 5:159600162-159600184 GTACTGCCCAGCAGAGCTGTGGG - Intergenic
1000269774 5:159672915-159672937 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1000546592 5:162610600-162610622 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1000635053 5:163634496-163634518 CCACTGACTAGCTGAGCCGTGGG - Intergenic
1001927579 5:175649756-175649778 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
1001958462 5:175864666-175864688 CCTTTGCCTAGGAGAGCTCCTGG + Intronic
1002079183 5:176727532-176727554 CCTCTGCCTATGAGAGAGGTGGG + Intergenic
1002530508 5:179841728-179841750 CCAATGCCCAGGTGGGCTGTGGG + Intronic
1003439279 6:6124140-6124162 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1003533561 6:6956905-6956927 CCGTTGCCTTGGAGAGGTGTTGG - Intergenic
1003659341 6:8045452-8045474 GCACTGCCTAGCGGAGTTGTGGG + Intronic
1003897555 6:10622051-10622073 CCAGTGGCTTGGAGAGCTGTCGG + Intronic
1004118608 6:12796586-12796608 CCAATGCCTAGCAGATATGTGGG - Intronic
1004552925 6:16667102-16667124 CCACTGCCTAGGATGGTTCTAGG - Intronic
1004624068 6:17358282-17358304 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1005597654 6:27394630-27394652 GCACTGCCTAGTGGAGCTGTAGG + Intronic
1006363977 6:33604020-33604042 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1006524007 6:34588614-34588636 CCACTCCCTAGCAGAGCAGAGGG - Exonic
1007342470 6:41200358-41200380 CCACTGCCTGTGAGAGGGGTGGG - Intronic
1007712811 6:43835455-43835477 CCACTGGCTACTAGAGCTGGAGG + Intergenic
1007940205 6:45773506-45773528 TCACTGGCTAGGTGACCTGTGGG - Intergenic
1008226217 6:48920113-48920135 GCACTGCCTGGTGGAGCTGTGGG + Intergenic
1010517369 6:76789804-76789826 GCACTCCCTAGTGGAGCTGTGGG - Intergenic
1011849100 6:91603723-91603745 GCACTGGCTAGCAGAGCTGTGGG - Intergenic
1012967067 6:105686574-105686596 CCCCTGCCTTTGAGATCTGTGGG + Intergenic
1013300196 6:108798114-108798136 CCTCTACCTAGTAGAGCTCTGGG - Intergenic
1014613084 6:123568376-123568398 GCATTGCCTAGTGGAGCTGTGGG - Intronic
1014835509 6:126156275-126156297 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
1015252608 6:131142679-131142701 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1016261318 6:142174084-142174106 TCACTGCTTAGTGGAGCTGTAGG + Intronic
1017699989 6:157059698-157059720 CTACTGCCTGGGAGACCTGGTGG + Intronic
1018510555 6:164520132-164520154 GCACTTCCTAGTGGAGCTGTGGG + Intergenic
1018527496 6:164729097-164729119 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1018545989 6:164936342-164936364 CCATTGACTAGCAGAGATGTTGG + Intergenic
1018658259 6:166061427-166061449 ACAATGCCTAGTAGAGCTGTGGG - Intergenic
1018662567 6:166101904-166101926 GCACTGCCTGGTGGAGCTGTGGG - Intergenic
1019002210 6:168763790-168763812 GCACTGCCTAATGGAGCTGTGGG - Intergenic
1019449266 7:1088354-1088376 CCACTGACTAGGGGAGCGGGTGG + Intronic
1019538711 7:1541854-1541876 CCCCTGCCTGGGGGAGCTGGCGG + Exonic
1020565328 7:9787789-9787811 GCACTTCCTAGTGGAGCTGTGGG - Intergenic
1020881099 7:13764194-13764216 CCCTAGCCTAGGAAAGCTGTAGG + Intergenic
1022627962 7:32057559-32057581 ACACTGCCGTGGAGAGCTTTGGG - Intronic
1022907621 7:34871953-34871975 ACACTGCCTAGTGGAGCTATGGG - Intronic
1023204033 7:37728893-37728915 CCATTGTCTATGGGAGCTGTGGG - Intronic
1023966884 7:44967424-44967446 CCACTGCACAGGTGAGATGTGGG - Intronic
1024877038 7:54037581-54037603 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
1026292285 7:69018535-69018557 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1026772746 7:73212608-73212630 CCACTTCCCAGGAGAGATCTGGG - Intergenic
1027013610 7:74766008-74766030 CCACTTCCCAGGAGAGATCTGGG - Intergenic
1027074428 7:75180025-75180047 CCACTTCCCAGGAGAGATCTGGG + Intergenic
1027180333 7:75934988-75935010 GCACTGCCTAGTGGAGCTGTGGG + Intronic
1028011354 7:85648613-85648635 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1029120019 7:98261552-98261574 GCACTGCCTAGTGCAGCTGTGGG - Intronic
1029952718 7:104604023-104604045 ACAATGCCTAGCGGAGCTGTGGG - Intronic
1030357290 7:108556771-108556793 ACACTGCCTAGTGGAGCTGTGGG - Intronic
1030516969 7:110550686-110550708 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1030722357 7:112884803-112884825 GCACTGCCTAGCAGAGTTTTAGG - Intronic
1030750602 7:113227344-113227366 GCACTGCCTGGTGGAGCTGTGGG + Intergenic
1030834481 7:114265582-114265604 GTACTGCCTAGTGGAGCTGTGGG - Intronic
1030841511 7:114359425-114359447 GTACTGCCTAGAAGAGCTGTGGG + Intronic
1030930864 7:115521993-115522015 GCATTGCCTAGTGGAGCTGTAGG - Intergenic
1031562566 7:123255916-123255938 GCAATGCCTAGTATAGCTGTAGG + Intergenic
1031792016 7:126118311-126118333 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1031993275 7:128211496-128211518 CCACTCTCAAGGACAGCTGTTGG - Intergenic
1033784858 7:144718091-144718113 GCACTGCCTAGTGGAGCTATGGG + Intronic
1036129260 8:6093026-6093048 CCACTTCTTATGACAGCTGTTGG + Intergenic
1037265188 8:17051340-17051362 CCAGTGCCTAGAAGAGTTTTTGG - Intronic
1037303579 8:17480930-17480952 TCCCTGCGTTGGAGAGCTGTGGG + Intergenic
1037313933 8:17583231-17583253 GCACTGCCTAGGGGAGCCATGGG + Intronic
1039158956 8:34595609-34595631 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1040978818 8:53223959-53223981 CCACTGTCAAGGAGAGATCTTGG - Intergenic
1041491521 8:58438300-58438322 GCACTGCCTAGTGGAGCTGTTGG + Intronic
1042990152 8:74630297-74630319 CCACTGCCTGGGAGAGAAGAGGG - Intronic
1043384200 8:79732110-79732132 GCATTGCCTAGTGGAGCTGTGGG - Intergenic
1045436974 8:102173488-102173510 GCACTGCCTAGTGGAGCTATGGG - Intergenic
1045438888 8:102190670-102190692 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1046656373 8:116899415-116899437 GCACTGACTAGTGGAGCTGTGGG + Intergenic
1047940481 8:129823793-129823815 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1048516196 8:135113811-135113833 GCACTGCCTAGTGGAGCTGTAGG + Intergenic
1048571581 8:135661265-135661287 GTACTGCCTAGTGGAGCTGTGGG - Intergenic
1049368292 8:142251447-142251469 CCACTGCTTATGGGAGGTGTCGG - Intronic
1050074891 9:1853143-1853165 GCACTGCCTAATTGAGCTGTGGG + Intergenic
1050095285 9:2058362-2058384 CCACTGCTTTGGAGAGCTTCTGG - Exonic
1050282453 9:4065140-4065162 CCACAGCCTGGGAGAGTTCTGGG - Intronic
1050976902 9:11950102-11950124 CCACTGCCTTAGAGATCTGTGGG - Intergenic
1055147924 9:72958731-72958753 GCATTGCCTAGTGGAGCTGTAGG - Intronic
1055225461 9:73989798-73989820 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1055800717 9:80032738-80032760 GCACTGCCTAGTGGAGCTCTGGG - Intergenic
1056397326 9:86193658-86193680 GCACTGCCTAGTGGAGCTGTGGG + Intergenic
1057191131 9:93088239-93088261 CCATTGCCCAGGAGAGCTGTGGG + Intergenic
1057588057 9:96347269-96347291 CCACCTCCTGGGAGAGCTGCAGG + Intronic
1058086430 9:100753065-100753087 GCATTGCCTAGTGGAGCTGTGGG - Intergenic
1058482170 9:105407112-105407134 ACAGAGCCTAGGAGACCTGTGGG + Intronic
1059601451 9:115783503-115783525 GCACTGCCTAGTGGAGCTATGGG + Intergenic
1059735255 9:117094030-117094052 CCACTGCCTAGAAGAGTGGCAGG + Intronic
1061027227 9:128057602-128057624 GCACTGCCTTGTAGATCTGTTGG + Intergenic
1061274353 9:129560987-129561009 ACACTGCCCGGGAGAGCTGAGGG + Intergenic
1061310956 9:129762153-129762175 CCATTTCCTAGGAGCCCTGTGGG + Intergenic
1185998252 X:4977826-4977848 CCAAGACCTAGGAGAGCTGGTGG + Intergenic
1187104177 X:16223201-16223223 GTATTGCCTAGTAGAGCTGTGGG - Intergenic
1188016354 X:25111939-25111961 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1188134924 X:26483659-26483681 ACACTGCCTAGTGGAGCTGTGGG + Intergenic
1189594350 X:42548361-42548383 ACACTGTCTAGTGGAGCTGTGGG - Intergenic
1189656605 X:43251233-43251255 GCACTGCCTAGTGGAGCTATGGG - Intergenic
1189871973 X:45393679-45393701 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1190153394 X:47967149-47967171 ACACTGCCTAGTGGAGCTGTAGG + Intronic
1190240651 X:48655378-48655400 CCAATGCCCAGTAGAGCGGTGGG - Intergenic
1190434949 X:50415066-50415088 CCAATGCCCAGCAGAGCTGTGGG + Intronic
1190512842 X:51191907-51191929 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1190794134 X:53725427-53725449 GCACTGCCTAGTAGGGCTGTGGG + Intergenic
1191211050 X:57885259-57885281 GCACTGCCTAATGGAGCTGTGGG - Intergenic
1192195699 X:69026455-69026477 GCACTGGCTTGGAGATCTGTAGG + Intergenic
1192311694 X:70021399-70021421 CCACAGCCTAGGAGAGTAGTAGG - Intronic
1192920006 X:75696572-75696594 GCACTGCCTAGTAAAGCTGTGGG - Intergenic
1193205181 X:78739682-78739704 GCACTGCCTAGTGGAGTTGTGGG - Intergenic
1193237936 X:79131580-79131602 GCACTGCCTAGTGGAGTTGTGGG + Intergenic
1193627315 X:83837308-83837330 GCACTGCCTAATAGAGATGTGGG - Intergenic
1193770362 X:85580753-85580775 GCATTGCCTAGTAGAGCTGTGGG - Intergenic
1193772613 X:85605613-85605635 GCACTGCCTAGTGGAGCTATGGG - Intergenic
1193972075 X:88067316-88067338 GCACGGCCTAGTGGAGCTGTGGG + Intergenic
1194119207 X:89939145-89939167 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1194952661 X:100145286-100145308 GCACTGCCTAGTGGAGCAGTAGG + Intergenic
1195035132 X:100965400-100965422 GTACTGCCTAGTGGAGCTGTGGG + Intergenic
1196020608 X:110987077-110987099 CCACTGCCTAGGTTTTCTGTGGG + Intronic
1196081493 X:111637638-111637660 GCAATGCCCAGAAGAGCTGTGGG + Intergenic
1197042020 X:121948715-121948737 ACACTGCCTACTGGAGCTGTGGG - Intergenic
1197342405 X:125288956-125288978 GTAATGCCTAGTAGAGCTGTTGG + Intergenic
1197460544 X:126735808-126735830 ACACTGCCTAGTGGAGCTTTGGG - Intergenic
1197570099 X:128139423-128139445 CCAAAGCCTATGACAGCTGTTGG - Intergenic
1197719196 X:129733465-129733487 GCACTGCCTAGTGGGGCTGTGGG + Intergenic
1198912856 X:141633791-141633813 GCACTGCCTAGTGTAGCTGTGGG + Intronic
1199128613 X:144157252-144157274 GTACTGCTTAGTAGAGCTGTGGG + Intergenic
1199261457 X:145780041-145780063 ACACTGCCTAATGGAGCTGTGGG + Intergenic
1199806461 X:151305461-151305483 ACACTGCCTAGTGGAGCTGTGGG - Intergenic
1200472080 Y:3596704-3596726 GCACTGCCTAGTGGAGCTGTGGG - Intergenic
1201569569 Y:15399620-15399642 GCACTGCCTAGTGGAGCTGTAGG + Intergenic