ID: 982198178

View in Genome Browser
Species Human (GRCh38)
Location 4:152936444-152936466
Sequence GCTCCCCGTGTCCCGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 93}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982198178_982198194 23 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198194 4:152936490-152936512 TCAGGGTTGGGGTGTTGTCCGGG 0: 1
1: 0
2: 0
3: 12
4: 198
982198178_982198185 5 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198185 4:152936472-152936494 CCCCGCCGCTCGGGAGGGTCAGG 0: 1
1: 0
2: 3
3: 103
4: 6384
982198178_982198192 12 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198192 4:152936479-152936501 GCTCGGGAGGGTCAGGGTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 369
982198178_982198187 6 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198187 4:152936473-152936495 CCCGCCGCTCGGGAGGGTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 141
982198178_982198180 -5 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198180 4:152936462-152936484 GGAGCTGGAGCCCCGCCGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 167
982198178_982198190 10 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198190 4:152936477-152936499 CCGCTCGGGAGGGTCAGGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 155
982198178_982198191 11 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198191 4:152936478-152936500 CGCTCGGGAGGGTCAGGGTTGGG 0: 1
1: 0
2: 1
3: 12
4: 137
982198178_982198182 -1 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198182 4:152936466-152936488 CTGGAGCCCCGCCGCTCGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 199
982198178_982198183 0 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198183 4:152936467-152936489 TGGAGCCCCGCCGCTCGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 121
982198178_982198193 22 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198193 4:152936489-152936511 GTCAGGGTTGGGGTGTTGTCCGG 0: 1
1: 0
2: 2
3: 22
4: 246
982198178_982198181 -4 Left 982198178 4:152936444-152936466 CCGCGGCGCGGGACACGGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 982198181 4:152936463-152936485 GAGCTGGAGCCCCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982198178 Original CRISPR GCTCCCCGTGTCCCGCGCCG CGG (reversed) Intronic