ID: 982198722

View in Genome Browser
Species Human (GRCh38)
Location 4:152938965-152938987
Sequence TGAGCTCCAAACTGACGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982198717_982198722 3 Left 982198717 4:152938939-152938961 CCACTGGTCCTCGTTCAGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 60
982198718_982198722 -5 Left 982198718 4:152938947-152938969 CCTCGTTCAGGAAAGCCCTGAGC 0: 1
1: 1
2: 6
3: 8
4: 152
Right 982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 60
982198713_982198722 25 Left 982198713 4:152938917-152938939 CCACTCATTCTGAGCACCAGGAC 0: 3
1: 0
2: 0
3: 13
4: 149
Right 982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 60
982198715_982198722 9 Left 982198715 4:152938933-152938955 CCAGGACCACTGGTCCTCGTTCA 0: 1
1: 0
2: 0
3: 10
4: 87
Right 982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982198722 Original CRISPR TGAGCTCCAAACTGACGGCC AGG Intronic
900191806 1:1355253-1355275 TGACCTCCAGGCGGACGGCCAGG + Exonic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
911044090 1:93614587-93614609 TCAGCTGCAAACTGGCTGCCAGG - Intronic
912760872 1:112366175-112366197 TGAGCCACAAACTAACTGCCTGG - Intergenic
917501920 1:175593405-175593427 TGAGCTGCAAACTGTTGGCTTGG - Intronic
919572207 1:199263044-199263066 TGAGCTCAAACCAGACTGCCTGG + Intergenic
919831342 1:201542165-201542187 TGAGCCCTAAACTGAAAGCCAGG - Intergenic
920040064 1:203089845-203089867 TCAGCTCCAACCTGACAGCAGGG + Intergenic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
1073831157 10:107384965-107384987 TCTGCTCCAAACTGAGGGCCAGG - Intergenic
1075739294 10:124684091-124684113 TGAGATACAAACTGAGGGGCTGG + Intronic
1075859014 10:125657722-125657744 TGAGCTCCCAGCTGAAGTCCAGG + Intronic
1080126064 11:28735361-28735383 CCATCTCCAAACTGACAGCCTGG - Intergenic
1091550534 12:1531872-1531894 TCGGCTCCACACTGACGGCACGG - Intronic
1093147618 12:15585648-15585670 TTAGCTCAAAACTGACAGCGAGG + Intronic
1096197352 12:49657204-49657226 TCAGCTCCCACCTGACTGCCTGG - Intronic
1096978214 12:55712468-55712490 CAAGCTCCAAACTGACTGGCTGG - Intronic
1105775824 13:23659208-23659230 TGAGCTCAAAACTTACAGCTGGG - Exonic
1106172605 13:27301063-27301085 AGCGCTCCAGACTCACGGCCTGG + Intergenic
1112038044 13:95515825-95515847 TTGGCTCCAAACTGACAGGCAGG + Intronic
1112174119 13:97004853-97004875 TGACTTCCTAACTGAAGGCCAGG - Intergenic
1116823798 14:49651896-49651918 CGAGCTCCAGTCTGAGGGCCTGG - Intronic
1120024874 14:79571496-79571518 TCAGCTACACACTGACTGCCGGG + Intronic
1122211270 14:100175599-100175621 TGGGCTCCCAGCTGACGGCACGG - Intergenic
1123917851 15:25050394-25050416 TGAGTTCCAGACTGACGTGCTGG + Intergenic
1124135571 15:27032937-27032959 AGAGGTCCCAACTGAGGGCCTGG + Intronic
1129646532 15:77439086-77439108 TGAACTCCAAACCTACGGACGGG - Intronic
1134034444 16:11018877-11018899 TGAAATCCAAACACACGGCCTGG - Intronic
1136252608 16:29015763-29015785 TGAGCTCCAGCCTGCCGGCCTGG + Intergenic
1149971959 17:61227666-61227688 TGTGCTCCAACCTGATGGGCTGG - Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1165309327 19:35021113-35021135 TGAGTCCCAAACTGACCTCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168343059 19:55636788-55636810 TGAGCTGAAACCTGAAGGCCAGG + Intronic
1168516020 19:57010842-57010864 TGAGCTCCACATTGAAGGCCTGG + Intergenic
927393983 2:22628365-22628387 TGAGGTCCAAACTCCAGGCCTGG - Intergenic
941224167 2:162824811-162824833 TGAGATGCAAACTGATGGCCAGG - Intronic
943180581 2:184535671-184535693 TAATTTCCAAACTGAGGGCCAGG + Intergenic
948729805 2:239955769-239955791 GCAGCTCCAAACCCACGGCCAGG + Intronic
1175450983 20:59067916-59067938 TTAGCTCCAAAATGACGTGCAGG - Intergenic
1181048250 22:20226721-20226743 TGCGCTGCAAGCTGAGGGCCTGG - Intergenic
1182103418 22:27672628-27672650 TGAGCACCATTCTGACAGCCAGG + Intergenic
1182112554 22:27733795-27733817 TGAGCTCCAAGCTTGTGGCCTGG - Intergenic
954660437 3:52224189-52224211 TGAGCTCCAGCCCCACGGCCTGG - Exonic
961651594 3:128419520-128419542 TGTGCTTCAAACTGACCACCAGG + Intergenic
967948160 3:194820406-194820428 TGAGTTACAAACTGATGTCCTGG - Intergenic
968181920 3:196601727-196601749 TGAGCACCACACTGACAGGCCGG + Intergenic
975647045 4:76555637-76555659 TGAGCTCCAAACTGCAGGCTGGG + Exonic
978873758 4:113612456-113612478 TTAGCTCAAGACTGACGGCATGG + Intronic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
987312407 5:16693413-16693435 TGAACTCCAAAGGGACAGCCTGG + Intronic
1001720020 5:173849263-173849285 TGAGTTCCTACCTGACAGCCAGG - Intergenic
1002311009 5:178313776-178313798 AGAGCTCCAGACTGAAGGTCTGG - Intronic
1007027626 6:38593261-38593283 AGATCTCCAAACTGACCTCCAGG + Intronic
1007128340 6:39446386-39446408 TTAGCTCCAAGCTCACTGCCTGG + Intronic
1007722482 6:43893335-43893357 TGGTCTCCAGACTGACGGCAAGG + Intergenic
1021476742 7:21070167-21070189 TGTGCTCCAAACTGTGGGCTAGG + Intergenic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1037141978 8:15531191-15531213 TGACCTCCAAGCTGCCTGCCTGG + Intronic
1038449786 8:27632803-27632825 CGAGCTCCCAGCTGCCGGCCAGG - Intergenic
1042872365 8:73410540-73410562 TCAGCTCCAAACTCACCGCCGGG - Intergenic
1048733074 8:137465646-137465668 TCAGCTGCAAACTGGTGGCCAGG - Intergenic
1048790732 8:138100939-138100961 TGCGCTCCAAACTCACGGAGTGG - Intergenic
1056843073 9:90014406-90014428 TGAACTCCACACTGAAGACCGGG - Intergenic
1062713410 9:137989017-137989039 GGAGCTGCAAACTGAGGGCTGGG + Intronic
1186868448 X:13745046-13745068 TGAGCACGAAACTGACAGACAGG - Intronic
1188509423 X:30919422-30919444 TGAGCTCTTCACTGAAGGCCTGG + Intronic
1188710014 X:33384719-33384741 GGAGCACCAGACTGACAGCCAGG - Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1193286090 X:79717012-79717034 TAAGCTCCCAACTGACGGAATGG + Intergenic