ID: 982199019

View in Genome Browser
Species Human (GRCh38)
Location 4:152942067-152942089
Sequence GACTGTGTATAAGGGACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982199013_982199019 10 Left 982199013 4:152942034-152942056 CCATAAAAATGCAACCCACTAAA 0: 1
1: 0
2: 4
3: 17
4: 285
Right 982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG 0: 1
1: 0
2: 0
3: 21
4: 295
982199015_982199019 -4 Left 982199015 4:152942048-152942070 CCCACTAAAGTAAGTTGGTGACT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG 0: 1
1: 0
2: 0
3: 21
4: 295
982199016_982199019 -5 Left 982199016 4:152942049-152942071 CCACTAAAGTAAGTTGGTGACTG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG 0: 1
1: 0
2: 0
3: 21
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982199019 Original CRISPR GACTGTGTATAAGGGACATG TGG Intronic
902622857 1:17660490-17660512 GACTGTGATAAAGGGACACGTGG - Intronic
903975921 1:27150212-27150234 GTCTGTGAATAGGGGAGATGGGG - Intronic
907009682 1:50952120-50952142 GACTGTGGAAACGGGAGATGAGG - Intronic
907522326 1:55032264-55032286 GACAGTGCAGAAGGGAAATGTGG + Intergenic
907584874 1:55608253-55608275 GGCAGTGTAAAAGGGAAATGTGG - Intergenic
908442617 1:64170158-64170180 GGCAGTGTAGAAGGGAAATGTGG - Intronic
909160915 1:72148127-72148149 GACAGTGCAGAAGGGAAATGTGG - Intronic
909235911 1:73152596-73152618 GACAGTGTGGAAGGGAAATGTGG - Intergenic
911541623 1:99164201-99164223 GACAGTGCAGAAGGGAAATGTGG + Intergenic
911881791 1:103249035-103249057 GACAGTGTCTTATGGACATGGGG + Intergenic
912006179 1:104903903-104903925 GACAGTGCAGAAGGGAAATGTGG - Intergenic
912009976 1:104947489-104947511 GACAGTGTGAAAGGGAAATGTGG + Intergenic
912080651 1:105932150-105932172 GGCTGTGCAGAAGGGAAATGTGG + Intergenic
912084522 1:105982212-105982234 GACAGTGCAGAAGGGAAATGTGG + Intergenic
912579120 1:110704468-110704490 GACAGTGTGGAAGGGAAATGTGG - Intergenic
912977154 1:114341184-114341206 TACTGTGTGGAAGGAACATGGGG + Intergenic
913554445 1:119950987-119951009 GACTGTATTTCAGGGACATGGGG - Intronic
915977732 1:160401424-160401446 GACTGTGTATAGGGGCCGAGGGG + Intronic
916927383 1:169537062-169537084 CACTGGGTATAAGTGCCATGAGG + Intronic
919156777 1:193775912-193775934 GACAGTGCAGAAGGGAAATGTGG - Intergenic
919247997 1:195013988-195014010 GACAGTGCAAAAGGGAAATGTGG - Intergenic
919554280 1:199031539-199031561 GACAGTGCAGAAGGGAAATGTGG - Intergenic
919862372 1:201748826-201748848 AACTTTATAAAAGGGACATGGGG - Intronic
921775694 1:219097196-219097218 GACAGTGCAGAAGGGAAATGTGG + Intergenic
922505578 1:226123655-226123677 GACTGTGTGTGAGGGACAGCGGG - Intergenic
924230288 1:241957093-241957115 GTGTGTGTAAAAGGGGCATGGGG + Intergenic
1064626411 10:17266292-17266314 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1065405375 10:25357753-25357775 GACAGTGTGAAAGGGAAATGTGG + Intronic
1066154206 10:32657295-32657317 GGCAGTGTAGAAGGGAAATGTGG - Intronic
1066451883 10:35537320-35537342 GACTGTGTGGAAGGGAAATGTGG + Intronic
1068439450 10:57032442-57032464 GACTGTGCAGAAAGGAAATGTGG + Intergenic
1068452640 10:57211941-57211963 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1069239630 10:66123587-66123609 GACAGTGCAGAAGGGAAATGTGG - Intronic
1071550039 10:86559850-86559872 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1073401342 10:103260074-103260096 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1074260509 10:111848726-111848748 GGCAGTGTAAAAGGGAAATGTGG + Intergenic
1077661975 11:4077682-4077704 AACTGAGCATAAGAGACATGTGG - Intronic
1078094300 11:8287163-8287185 GCTGGTGGATAAGGGACATGTGG - Intergenic
1078674101 11:13393319-13393341 GTTGGTGTATAAGAGACATGAGG - Intronic
1079398468 11:20086233-20086255 TTCTGTGTATAAGGAATATGGGG + Intronic
1079652101 11:22942550-22942572 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1080814367 11:35739730-35739752 GACTGTGTATCATGGATCTGAGG - Intronic
1081136904 11:39450205-39450227 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1081541944 11:44040879-44040901 GAATGTTTATAAGGGCAATGGGG + Intergenic
1085131024 11:74038731-74038753 GAAGGTGTTTAAGGGACAGGTGG - Intronic
1085890502 11:80573390-80573412 GGCAGTGCATAAGGGAAATGTGG - Intergenic
1086173252 11:83860124-83860146 GGCAGTGTAGAAGGGAAATGTGG + Intronic
1087393610 11:97569699-97569721 GGCAGTGCAGAAGGGACATGTGG - Intergenic
1087654849 11:100909991-100910013 GAGTGTATAAAATGGACATGTGG + Intronic
1087668988 11:101083347-101083369 GACAGTGTGAAAGGGAAATGTGG + Intronic
1087908263 11:103724434-103724456 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1088762809 11:112948408-112948430 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1089652617 11:119924234-119924256 GACTGTGGATTAGGGGGATGTGG + Intergenic
1092012553 12:5126965-5126987 GACTGTGCATTAGGGAAAAGAGG - Intergenic
1093751557 12:22805853-22805875 CAAAGTGTAGAAGGGACATGGGG - Intergenic
1093960926 12:25271987-25272009 GTGTGTGTGTAAGGGCCATGGGG + Intergenic
1094420281 12:30263834-30263856 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1095039720 12:37427592-37427614 GGCTGTGCAGAAGGGAAATGTGG + Intergenic
1095382833 12:41615703-41615725 GGCAGTGCATAAGGGAAATGTGG + Intergenic
1096194816 12:49643023-49643045 AAGCGTGTAGAAGGGACATGGGG + Exonic
1097146587 12:56943594-56943616 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1098686987 12:73434331-73434353 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1099407914 12:82285492-82285514 GACAGTGTGGAAGGGAAATGTGG + Intronic
1100678480 12:96893595-96893617 GGCAGTGTGTAAGGGAAATGTGG + Intergenic
1100915224 12:99412793-99412815 GACTGTATATAAGAGATTTGAGG + Intronic
1104342838 12:127967344-127967366 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1105696248 13:22891841-22891863 GACTGTGTATACAGAATATGAGG - Intergenic
1105863465 13:24438265-24438287 AACTGTGCATATGGAACATGTGG - Intronic
1105914311 13:24898240-24898262 GACTATGTATAGGTGAAATGAGG + Intronic
1106639653 13:31570544-31570566 GAGTGTGGATATGGGAAATGAGG - Intergenic
1106678336 13:31984846-31984868 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1106756669 13:32828908-32828930 GACTGTGTGTCAGGGAGAGGAGG + Intergenic
1107234597 13:38153367-38153389 GGCAGTGTAGAAGGGAAATGTGG - Intergenic
1108394870 13:49982223-49982245 GATTGTGTAGAAGGACCATGTGG + Intergenic
1109491075 13:63100840-63100862 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1109853722 13:68102042-68102064 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1110250662 13:73377233-73377255 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1110489502 13:76086894-76086916 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1110926847 13:81164510-81164532 GACCGTGCAGAAGGGAAATGTGG - Intergenic
1111221339 13:85208677-85208699 GACAGTGCATAAGGGAAATGTGG + Intergenic
1112582726 13:100690487-100690509 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1113957823 13:114108541-114108563 GACAGGGGATAATGGACATGGGG - Intronic
1114706999 14:24737564-24737586 GGCTGTGCAGAAGGGAAATGTGG - Intergenic
1115009115 14:28522650-28522672 GGCTGTGCATAAGGGAAATGTGG + Intergenic
1115820333 14:37206480-37206502 GGCAGTGCATAAGGGAAATGTGG + Intronic
1117708522 14:58498882-58498904 GACTGTGTATTAGTGACAGGTGG - Exonic
1118486078 14:66215573-66215595 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1119101090 14:71880766-71880788 GGCTGTGTGGAAGGGAAATGTGG + Intergenic
1120091110 14:80334201-80334223 GGCAGTGTAGAAGGGAAATGTGG - Intronic
1124066312 15:26347253-26347275 GACTGTGTGGAAGGGAAATGTGG + Intergenic
1128443769 15:67738656-67738678 GACAGTGTATAGAGGAGATGGGG + Intronic
1129119292 15:73385943-73385965 AGCAGTGTATAAAGGACATGGGG + Intergenic
1129864144 15:78890243-78890265 GACAGTATATAAGTGACGTGAGG + Intronic
1130942527 15:88523452-88523474 GACTGTGTAAAGGGGAGAAGAGG - Intronic
1133504564 16:6398903-6398925 GACAGTGCAGAAGGGAAATGTGG - Intronic
1133885688 16:9825617-9825639 GCCTGTAAATAAGGGACATCTGG + Intronic
1137736685 16:50729695-50729717 GGATGTGTCTAAGGGACAGGTGG + Intronic
1143371061 17:6439771-6439793 GACAGGGTATAAGGGGCATGGGG - Intergenic
1146146692 17:30425040-30425062 GAGTATGTAGAAGGGACTTGTGG - Intronic
1146465222 17:33080950-33080972 GACTGTGTGTAACTGACATCAGG + Intronic
1149480697 17:57000949-57000971 GACGGTGTATAATGGACAGCTGG + Exonic
1151223782 17:72633391-72633413 GACTGTGTGATGGGGACATGAGG + Intergenic
1152032091 17:77849428-77849450 GACGCTGGATAAGGGAAATGTGG - Intergenic
1153455002 18:5271223-5271245 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1155178216 18:23320167-23320189 AACTGAGCATAAGAGACATGAGG - Intronic
1155666278 18:28313039-28313061 GACTGTGTCTAAGTGATTTGAGG + Intergenic
1156715737 18:40007766-40007788 GGCTGGGGATAAGGGAAATGGGG - Intergenic
1157883300 18:51342293-51342315 GATTGTGTACAGGGGACAAGTGG + Intergenic
1159641226 18:70864937-70864959 GGCTGTGTAGATGGGAAATGTGG + Intergenic
1159697324 18:71575893-71575915 AACAGTGTGTAAGGGAAATGTGG - Intergenic
1160041975 18:75353606-75353628 GACAGTGTGTAAGGGAAATGTGG + Intergenic
1161933244 19:7355395-7355417 GACTGGGTTTAAGGGACAGAGGG + Intronic
1162657483 19:12141924-12141946 CACAGTTTATAAGAGACATGTGG - Intronic
1164472196 19:28545619-28545641 GCCTGTGTTTAAGGTCCATGGGG - Intergenic
1166526419 19:43513208-43513230 GACAGTGCAGAAGGGAAATGTGG + Intronic
925638428 2:5964922-5964944 GACAGTGCAGAAGGGAAATGTGG - Intergenic
927030558 2:19116810-19116832 GACAGTGCAGAAGGGAAATGTGG - Intergenic
927695055 2:25234268-25234290 GCGTGTGTGTAAGGGACATGGGG - Exonic
928575553 2:32651185-32651207 GTGTGTGTCCAAGGGACATGAGG + Intronic
931903673 2:66820189-66820211 GCTTGTGTGTAAGGGACATGGGG - Intergenic
932312780 2:70757268-70757290 GCCTGTGGATAAGGGATTTGTGG + Intronic
933203956 2:79483552-79483574 AAATGTGTACAAGGGAGATGAGG - Intronic
934700865 2:96439074-96439096 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
934975448 2:98799113-98799135 CACTGTGTAGAAGGGAACTGAGG - Intronic
935481455 2:103594959-103594981 GGCAGTGCAGAAGGGACATGTGG + Intergenic
936161824 2:110089183-110089205 GGCAGTGCAGAAGGGACATGTGG + Intronic
936182839 2:110282171-110282193 GGCAGTGCAGAAGGGACATGTGG - Intergenic
936831809 2:116655926-116655948 GACAGTGTGGAAGGGAAATGTGG - Intergenic
939129080 2:138212662-138212684 GTCTGTGCATGAGGGCCATGAGG + Intergenic
940213933 2:151285129-151285151 GAGTATGTGAAAGGGACATGGGG + Intronic
940288938 2:152059150-152059172 GACAGTGCAGAAGGGAAATGTGG + Intronic
940408810 2:153336168-153336190 GACAGTGCAGAAGGGAAATGTGG + Intergenic
940826227 2:158415902-158415924 GACAGTGTAGAGGGGAAATGTGG - Intronic
942425878 2:175860032-175860054 GAAAGTGTAGAAGGGAGATGAGG - Intergenic
942665878 2:178316796-178316818 CATTATGTATAAGGGACTTGAGG + Intronic
942670254 2:178367720-178367742 AAATGTGCATAAGGGACATGAGG + Intronic
944010126 2:194965014-194965036 GGCTGTGCAGAAGGGAAATGTGG - Intergenic
946288499 2:218724650-218724672 GACTATGAATAAAGGAAATGTGG - Intronic
946303280 2:218839143-218839165 CACTGTGTATAAAAGACATCTGG - Intergenic
946410301 2:219512183-219512205 AACTGGGTATAAGGGGCATGCGG - Intergenic
946760571 2:222989308-222989330 GACAGTGCAGAAGGGAAATGTGG - Intergenic
946791733 2:223307811-223307833 GAGTTTATATAAGGGAAATGCGG - Intergenic
946988638 2:225302904-225302926 GACAGTGTGGAAGGGAAATGTGG + Intergenic
947008422 2:225538266-225538288 GACAGTGTGGAAGGGAAATGTGG - Intronic
947886496 2:233576284-233576306 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1173412774 20:42828876-42828898 GACAGTGCAGAAGGGAAATGTGG + Intronic
1175013583 20:55764660-55764682 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG + Intergenic
1176677864 21:9797494-9797516 GACTGTGCATAAGAAACATCTGG - Intergenic
1177614406 21:23499013-23499035 GGCAGTGTAGAAGGGAAATGGGG - Intergenic
1177740279 21:25146106-25146128 GGCTGTGCAGAAGGGAAATGTGG - Intergenic
1178013725 21:28318013-28318035 GACAGTGCATAAGGGAAATGTGG + Intergenic
1180573682 22:16752704-16752726 GGCTGTGCAGAAGGGAAATGTGG + Intergenic
1182815198 22:33156135-33156157 GGCAGTGTGGAAGGGACATGAGG + Intergenic
1183058085 22:35319236-35319258 CCATGTTTATAAGGGACATGGGG - Intronic
1184374599 22:44103684-44103706 GTCTGTATAAGAGGGACATGGGG + Intronic
1184490037 22:44803209-44803231 GGGAGTGTACAAGGGACATGGGG - Intronic
949213539 3:1536275-1536297 AACTTTGAAAAAGGGACATGAGG - Intergenic
952480205 3:33753659-33753681 GACAGTGCAGAAGGGAAATGTGG - Intergenic
952589374 3:34932420-34932442 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
952671534 3:35974732-35974754 GACAGTGCAGAAGGGAAATGTGG - Intergenic
952831383 3:37568018-37568040 GACAGTGTGGAAGGGAAATGTGG - Intronic
955138735 3:56247712-56247734 GTCGGTGCATAAGGGAAATGAGG + Intronic
956391659 3:68779774-68779796 GACAGTGAAGAAGGGAAATGTGG + Intronic
957407488 3:79790436-79790458 GGCAGTGTGTAAGGGAAATGTGG - Intergenic
957662858 3:83183855-83183877 GACAGTGCAGAAGGGAAATGTGG + Intergenic
957956594 3:87196161-87196183 GGCAGTGCATAAGGGAAATGTGG + Intergenic
958550572 3:95607154-95607176 GACAGTGTGGAAGGGAAATGTGG - Intergenic
958600359 3:96289050-96289072 GGCTGTGCAGAAGGGAAATGTGG + Intergenic
958879750 3:99656313-99656335 TACTGTGTGTTAGGGAGATGAGG - Intronic
958945151 3:100354175-100354197 GACTGGGTAGAAGTGGCATGGGG - Intronic
959719377 3:109469953-109469975 GACAGTGCAGAAGGGAAATGTGG + Intergenic
960164008 3:114381280-114381302 GATTGTGTGTTTGGGACATGAGG + Intronic
965089981 3:164149626-164149648 GGCAGTGCATAAGGGAAATGTGG - Intergenic
965101919 3:164309541-164309563 GACAGTGCAGAAGGGAAATGTGG - Intergenic
966442678 3:179963813-179963835 GACTGTGCATAAGAAACATAGGG - Intronic
967899229 3:194431225-194431247 GCCTGTGTATATGAGACATTGGG + Exonic
968567236 4:1319545-1319567 GGCTGTGTTGACGGGACATGAGG + Intronic
968609628 4:1551133-1551155 CAGTGTGTCTAAGGGCCATGGGG + Intergenic
969182265 4:5451378-5451400 GACAGTCTATAAAGGACCTGAGG + Intronic
969993040 4:11283817-11283839 GACAGTGCAGAAGGGAAATGTGG - Intergenic
969996407 4:11317294-11317316 GACAGTGTGGAAGGGAAATGTGG - Intergenic
971546302 4:27891255-27891277 GGCTGTGTGGAAGGGAAATGTGG + Intergenic
971600199 4:28582298-28582320 GACAGTGTGGAAGGGATATGTGG + Intergenic
972014516 4:34226595-34226617 GACAGTGCAGAAGGGAAATGTGG + Intergenic
972890754 4:43553671-43553693 GACAGTGCAAAAGGGAAATGTGG + Intergenic
973094506 4:46179860-46179882 GACAGTGCAAAAGGGAAATGTGG + Intergenic
974153722 4:58043749-58043771 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
975350383 4:73339381-73339403 GACAGTGCAGAAGGGAAATGTGG - Intergenic
976949768 4:90813935-90813957 GGCAGTGCAGAAGGGACATGTGG - Intronic
977021477 4:91765599-91765621 GACAGTGCAAAAGGGATATGTGG + Intergenic
977365961 4:96068306-96068328 GACCGTGTGGAAGGGAAATGTGG - Intergenic
978087129 4:104667925-104667947 GACAGTGTGAAAGGGAAATGTGG - Intergenic
978966104 4:114743737-114743759 TACTGTGTATAAAGTAAATGTGG + Intergenic
978991264 4:115084844-115084866 GACAGTGTGGAAGGGAAATGTGG + Intronic
979925161 4:126553688-126553710 GACTGTGGATAAAATACATGAGG + Intergenic
980646127 4:135644338-135644360 GACAGTGAAGAAGGGACATATGG + Intergenic
981795391 4:148589681-148589703 GACAGTGCAGAAGGGAAATGTGG + Intergenic
981861513 4:149361766-149361788 GACAGTGCAGAAGGGAAATGTGG + Intergenic
982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG + Intronic
982389890 4:154852635-154852657 GGCAGTGCATAAGGGAAATGTGG - Intergenic
985183982 4:187296337-187296359 GACAGTGGATAAGGGAAATGTGG - Intergenic
985397660 4:189561295-189561317 GACTGTGCATAAGAAACATCTGG + Intergenic
987252292 5:16112109-16112131 GGCTGTGCAGAAGGGAAATGTGG + Intronic
987260373 5:16196364-16196386 GGCAGTGTGGAAGGGACATGTGG - Intergenic
988172939 5:27682812-27682834 GACAGTGCATAAGGTAAATGTGG - Intergenic
988493905 5:31728223-31728245 GTCTGTGTAATGGGGACATGGGG - Intronic
988740085 5:34061445-34061467 GACAGTGTGGAAGGGAAATGTGG - Intronic
991163744 5:63536797-63536819 GAGTTTCTTTAAGGGACATGAGG - Intergenic
992666262 5:79012539-79012561 GACAGTGTAGAGGGGAAATGTGG - Intronic
994234230 5:97342727-97342749 GGCAGTGTAGAAGGGAAATGTGG - Intergenic
994434294 5:99708176-99708198 GACAGTGCAGAAGGGAAATGTGG - Intergenic
994542782 5:101121387-101121409 GACAGTGCAGAAGGGAAATGTGG - Intergenic
994546757 5:101176839-101176861 GACAGTGTAAAGGGGACATGTGG + Intergenic
995311464 5:110717040-110717062 CACTTTGTACCAGGGACATGAGG + Intronic
995925558 5:117369509-117369531 GACAGTGTAGAAGGGAAATTTGG + Intergenic
996214306 5:120848693-120848715 GGCAGTGCATAAGGGAAATGTGG - Intergenic
996257768 5:121426519-121426541 GTCAGTGTGTAAGGGAAATGTGG - Intergenic
999436885 5:151570232-151570254 CCCTGTCTATAAGGGACATGTGG - Intergenic
999541105 5:152573279-152573301 GGCAGTGCATAAGGGAAATGTGG + Intergenic
1000424026 5:161069957-161069979 CACAGAGTATAAGAGACATGTGG + Intergenic
1002077592 5:176718097-176718119 GCCTCTGGATAAGGGACAGGAGG - Intergenic
1003529841 6:6928276-6928298 GACTTAGTAAAAGGGACATGTGG + Intergenic
1004805701 6:19201676-19201698 GGCAGTGCAGAAGGGACATGTGG - Intergenic
1004834588 6:19516414-19516436 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1007223491 6:40296808-40296830 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1009316078 6:62223072-62223094 GACTGTGCAGAAGGGAAATGTGG - Intronic
1010282621 6:74038612-74038634 GACAGTGGAGAAGGGAAATGTGG + Intergenic
1010549280 6:77201288-77201310 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1010920354 6:81673096-81673118 GGCTGTGTGGAAGGGAAATGTGG - Intronic
1011110643 6:83833790-83833812 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1011732954 6:90284553-90284575 GGCTGTGTTTGAGGGAAATGTGG - Intronic
1011844989 6:91552218-91552240 GACAGTGTGAAAGGGAAATGTGG - Intergenic
1012788168 6:103658333-103658355 GGCAGTGTGTAAGGGAAATGTGG - Intergenic
1015901773 6:138075169-138075191 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1015969591 6:138730726-138730748 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1019150407 6:170001693-170001715 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1020755028 7:12191089-12191111 GGCTGTGCAGAAGGGAAATGTGG - Intergenic
1022660517 7:32362265-32362287 GGGTGTATATAAGAGACATGGGG + Intergenic
1024207582 7:47177087-47177109 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1025300356 7:57815029-57815051 GGCTGTGCAGAAGGGAAATGTGG - Intergenic
1027624778 7:80532192-80532214 GACAGTGCAAAAGGGAAATGTGG + Intronic
1031396908 7:121284955-121284977 GACAGTGCAGAAGGGAAATGTGG - Intronic
1031674252 7:124589350-124589372 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1032179188 7:129660885-129660907 TACAGTGTGTAAGGGAAATGTGG - Intronic
1033419697 7:141194740-141194762 GGCAGTGTGTAAGGGAAATGTGG - Intronic
1033833087 7:145276609-145276631 GACAGTGTGAAAGGGAAATGTGG + Intergenic
1034507684 7:151507468-151507490 GACTCTATATGACGGACATGTGG - Intronic
1034751335 7:153571657-153571679 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038618102 8:29114582-29114604 GTGTGTGTATTAGGGTCATGTGG + Intronic
1039071392 8:33652231-33652253 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1039121968 8:34157610-34157632 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1039657261 8:39423359-39423381 GACAGTGTGGAAGGGAAATGTGG - Intergenic
1041898642 8:62956561-62956583 GAATGTGTATAGGGGAAGTGGGG + Intronic
1042646064 8:70987764-70987786 GACAGTGTAGAAGGAAAATGTGG - Intergenic
1043241206 8:77937911-77937933 GACAGTGCAAAAGGGAAATGTGG - Intergenic
1043591125 8:81834956-81834978 GGCTGTGTGGAAGGGAAATGTGG - Intronic
1044273656 8:90275425-90275447 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1045848415 8:106663828-106663850 GACTATGGATTATGGACATGTGG - Intronic
1047594907 8:126368481-126368503 GACTGTGCAGCTGGGACATGGGG - Intergenic
1048463767 8:134644619-134644641 GATTGTGTATACGGTACATTTGG - Intronic
1050079818 9:1904447-1904469 GACAGTGTGAAAGGGAAATGTGG + Intergenic
1050137409 9:2481086-2481108 GGCTGTGAAGAAGGGAAATGTGG - Intergenic
1050849322 9:10264163-10264185 GACAGTGTGGAAGGGAAATGTGG + Intronic
1050940539 9:11452026-11452048 GGCAGTGCATAAGGGAAATGTGG + Intergenic
1051013549 9:12448124-12448146 GACAGTGTAGAAGGGAAATGTGG + Intergenic
1051285573 9:15492638-15492660 GACTGTGTGGAAGGGAAATGTGG - Intronic
1051915056 9:22198357-22198379 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1052105566 9:24510434-24510456 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1052545627 9:29874146-29874168 GAAAGAGTTTAAGGGACATGAGG - Intergenic
1053330122 9:37197963-37197985 GACTGTCTATAAGGAAAAAGGGG + Intronic
1053882637 9:42611399-42611421 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1053890032 9:42682903-42682925 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1053893442 9:42719072-42719094 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1054221664 9:62418867-62418889 GACAGTGCAGAAGGGAAATGTGG - Intergenic
1054229050 9:62490306-62490328 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1055167916 9:73219388-73219410 GGCAGTGTGGAAGGGACATGTGG + Intergenic
1055363997 9:75524947-75524969 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1055774354 9:79751923-79751945 GGCAGTGTAGAAGGGAAATGTGG - Intergenic
1059462176 9:114439145-114439167 GAATGGGTAGAAGGGACATGGGG + Intronic
1059740551 9:117145563-117145585 GACTGTGGAAAAGGGACACTGGG - Intronic
1059778122 9:117497141-117497163 AACAGTGCCTAAGGGACATGTGG - Intergenic
1060549908 9:124479980-124480002 GGGTGTGTATAGGGGACAAGAGG - Intergenic
1062739194 9:138158365-138158387 GACTTTGTTTAAAGTACATGTGG + Intergenic
1186207547 X:7216218-7216240 GATGGTGAATAAGTGACATGTGG + Intergenic
1186655239 X:11605125-11605147 GATTGTGCACAAGGGACAGGAGG + Intronic
1188616530 X:32165084-32165106 GACAGTGTGGAAGGGAAATGTGG + Intronic
1188856997 X:35209022-35209044 GGCAGTGCATAAGGGAAATGTGG - Intergenic
1188947086 X:36318451-36318473 CATTTTGTATCAGGGACATGGGG - Intronic
1189669731 X:43395129-43395151 GGCAGTGCAGAAGGGACATGTGG - Intergenic
1193050684 X:77096293-77096315 GACAGTGTGGAAGGGAAATGTGG + Intergenic
1193577626 X:83221731-83221753 GACTGTGGATAAGGGAAAATGGG + Intergenic
1193732102 X:85113956-85113978 GACTGTGTATACAGGGTATGAGG + Intergenic
1194145291 X:90254753-90254775 GGCAGTGTGTAAGGGAAATGTGG - Intergenic
1194397516 X:93403990-93404012 GGCAGTGTAGAAGGGAAATGTGG - Intergenic
1194643966 X:96435507-96435529 GACTATGTAAAAGACACATGTGG + Intergenic
1195525900 X:105889522-105889544 GGCAGTGTAGAAGGGAAATGCGG - Intronic
1195816795 X:108896855-108896877 GACAGTGCTTAAGGGAAATGTGG + Intergenic
1196173258 X:112613039-112613061 GACTGTGCATGAGGGACAGTGGG + Intergenic
1196187529 X:112760713-112760735 GACTGTGTATCAGAGTAATGTGG + Intergenic
1196537403 X:116863344-116863366 GACTGTGTTTTAGGGTCATTTGG + Intergenic
1196996298 X:121387894-121387916 GACAGTGCAGAAGGGAAATGTGG + Intergenic
1197349768 X:125369785-125369807 GACAGGGTAGAAGGGAAATGTGG - Intergenic
1197437760 X:126453163-126453185 TACAGTGTAGAAGGGAAATGTGG + Intergenic
1198734638 X:139772358-139772380 GACAGTGCAGAAGGGAAATGTGG + Intronic
1198912841 X:141633736-141633758 GCCTGTGTGGAAGGGAAATGTGG + Intronic
1198996385 X:142578490-142578512 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1199321361 X:146442827-146442849 GACTGTGTAGATGAGATATGAGG + Intergenic
1199400731 X:147395575-147395597 GGCAGTGTAGAAGGGAAATGTGG + Intergenic
1200230225 X:154440220-154440242 GGCTGAGTACAAGAGACATGCGG - Intronic
1200268924 X:154662844-154662866 GGCAGTGTAGAAGGGATATGTGG + Intergenic
1200491053 Y:3824051-3824073 GGCAGTGTGTAAGGGAAATGTGG - Intergenic
1200899960 Y:8420341-8420363 GACAGTGTTTAAAGGAAATGTGG + Intergenic
1201510920 Y:14761672-14761694 GACTGTGGATTAGGTAGATGTGG - Intronic
1201704581 Y:16922154-16922176 GCCTGTGTGTGAGGGAGATGGGG - Intergenic