ID: 982199236

View in Genome Browser
Species Human (GRCh38)
Location 4:152943769-152943791
Sequence GCATGAGGTCATAATCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982199236_982199238 -5 Left 982199236 4:152943769-152943791 CCTGGTGGATTATGACCTCATGC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 982199238 4:152943787-152943809 CATGCAGAGAACATGCTATTTGG 0: 1
1: 0
2: 0
3: 13
4: 146
982199236_982199239 -4 Left 982199236 4:152943769-152943791 CCTGGTGGATTATGACCTCATGC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 982199239 4:152943788-152943810 ATGCAGAGAACATGCTATTTGGG 0: 1
1: 0
2: 2
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982199236 Original CRISPR GCATGAGGTCATAATCCACC AGG (reversed) Intronic
900466113 1:2826266-2826288 GCATGAGAACATTCTCCACCTGG - Intergenic
900918924 1:5658648-5658670 CCTTGATGTCATAAGCCACCAGG - Intergenic
905875993 1:41432438-41432460 AAATGAGGTCATAATCCCACAGG + Intergenic
908993792 1:70127584-70127606 GCATGAGCTCAGAACCCAACTGG - Intronic
910960280 1:92754865-92754887 ACATGAGGTCATTAGCCTCCAGG - Intronic
912203040 1:107480100-107480122 GCATGAAGACAGAACCCACCGGG - Intronic
1072086912 10:92088722-92088744 GAATAAGGTAAAAATCCACCTGG + Intronic
1075374335 10:121965864-121965886 GCATGAGGGCAGAATCCAGAAGG - Intronic
1076286727 10:129306551-129306573 GCATGAGAACTTAATCCAGCAGG - Intergenic
1085526271 11:77166084-77166106 GCATGGGGACATTATCCAGCTGG + Exonic
1094049519 12:26203947-26203969 GCATGGGGTCCTAATCCAACAGG - Intronic
1099292741 12:80791753-80791775 GCATAAGGACACAATCCACAAGG - Intergenic
1099778125 12:87160702-87160724 GCATGAAGTTCTAATCCACTAGG - Intergenic
1100133422 12:91524096-91524118 GTAGGAGGTCATAGTCCTCCAGG - Intergenic
1101756049 12:107621235-107621257 GCTTGAGGTCAAGACCCACCAGG + Intronic
1101879375 12:108616174-108616196 GCTTGAGGTCATTAGCCATCAGG - Intergenic
1103620831 12:122186195-122186217 TCAGGAGGTCTTTATCCACCAGG - Exonic
1104649740 12:130522883-130522905 TCATGAGATCCTAATCCAACAGG + Intronic
1104876016 12:132035376-132035398 ACATGAGCTCATTTTCCACCTGG - Intronic
1106245236 13:27944109-27944131 GCATGAGGTCAAACTGCACAGGG + Intergenic
1106721811 13:32442293-32442315 GCATGAGATCACTAACCACCAGG + Intronic
1107114801 13:36735099-36735121 TCATGAGGACATAATCCATCAGG + Intergenic
1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG + Intergenic
1108575153 13:51784177-51784199 CCTTGAGGGCAGAATCCACCTGG - Intronic
1109269348 13:60236907-60236929 GGATGGGGTTATAATCCAGCAGG + Intergenic
1112311535 13:98321561-98321583 GCATCAGGTCATCATCCCCCTGG - Intronic
1113525384 13:110970717-110970739 ACATGAGGTGATAAGACACCTGG + Intergenic
1114935760 14:27534290-27534312 GTGTGAGTTCATAATCCAGCAGG - Intergenic
1115062681 14:29212546-29212568 CCTGGAGGTCATTATCCACCAGG - Intergenic
1119941632 14:78647441-78647463 GGATGAGCTCATAATCCTTCTGG - Intronic
1124184809 15:27515301-27515323 TCAGGAGTTCAAAATCCACCTGG - Intronic
1125598222 15:40900891-40900913 ACTTGAGGTCGTAATGCACCCGG - Exonic
1129090783 15:73148091-73148113 GCATGAGATTATACTGCACCTGG + Intronic
1130148500 15:81293472-81293494 TCCTGAGCTCATGATCCACCCGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132462205 16:61263-61285 GCAGGAGGCCCTCATCCACCTGG - Exonic
1142385283 16:89760143-89760165 GCATGAGGTCATGCTGCATCAGG - Intronic
1143346775 17:6255313-6255335 ACATGATGTAATAGTCCACCCGG - Intergenic
1144032259 17:11333443-11333465 GCTTGAGTTAATAATCCATCAGG + Intronic
1149601489 17:57895853-57895875 GCATGAGCTCATACTGGACCAGG + Intronic
1152154229 17:78622517-78622539 GCATGGGGGCCTATTCCACCTGG - Intergenic
1157627527 18:49062895-49062917 GAAGGAGATTATAATCCACCTGG + Intronic
1161183031 19:2898302-2898324 CCATGAGTTCAAAATCAACCTGG + Intergenic
1161794066 19:6376343-6376365 GCATGATGTCCTAATCCTCCAGG - Intronic
1164735752 19:30539801-30539823 GCATGAGGTGCTCACCCACCAGG - Intronic
1167473559 19:49688122-49688144 GCATGAGGGCGGAACCCACCAGG - Intronic
1167474215 19:49690831-49690853 GCCTGACGTTATAATGCACCTGG + Intergenic
926838954 2:17057319-17057341 GCATGAGGTCATAAGACAATGGG + Intergenic
930116720 2:47724536-47724558 GCATGAAGTCAGAACCAACCTGG - Intronic
930334632 2:50029476-50029498 GCATGGGATCCTAATCCAACAGG + Intronic
933238478 2:79892452-79892474 GTATTATTTCATAATCCACCAGG - Intronic
935867403 2:107405230-107405252 GCAGGAGTTCAAAATCAACCTGG + Intergenic
941231174 2:162914063-162914085 GGATGTGGTCATAATCGCCCTGG + Intergenic
944901405 2:204220258-204220280 GGATGAGGCCCTAATCCAACAGG - Intergenic
945730074 2:213522552-213522574 GTATAAGGTCATATTCCTCCAGG - Intronic
948614355 2:239188826-239188848 GCCTGAGGTCCTCATCCACAGGG - Intronic
1175092152 20:56513329-56513351 GCATGATGACATCATCCTCCTGG - Exonic
1176916296 21:14629675-14629697 GCACGGGGCCATAATCCATCAGG + Intronic
1177675555 21:24294370-24294392 GCATGAGGAAATAAGCCACGTGG + Intergenic
1182759324 22:32709148-32709170 GCAAGAGGTCATTTTCCCCCGGG - Intronic
949395606 3:3611850-3611872 GCATGAGCTCCTAAACAACCTGG + Intergenic
954300266 3:49697433-49697455 CCAGCAGGTCATCATCCACCAGG - Exonic
965538699 3:169851160-169851182 GCAGGTGGGCATGATCCACCAGG + Intronic
970734763 4:19152791-19152813 GAATGAAGTCATATTCCAGCTGG - Intergenic
970774824 4:19661135-19661157 CCAGGAGCTGATAATCCACCTGG + Intergenic
974116833 4:57589377-57589399 GGATGTGGTCCTAATCCACTAGG + Intergenic
980532865 4:134076870-134076892 GCATGATGTCATCATCCAGATGG + Intergenic
980899459 4:138890687-138890709 GCATGAGGCCATCATCCATCTGG - Intergenic
982199236 4:152943769-152943791 GCATGAGGTCATAATCCACCAGG - Intronic
984690757 4:182723179-182723201 ACATGAGGTCCAAAGCCACCAGG + Intronic
985808266 5:2064236-2064258 GAATGAGGTCAGTATCCACCTGG + Intergenic
988972602 5:36484542-36484564 GCATGAGGTCAGAGTCTAACTGG - Intergenic
1000829219 5:166082630-166082652 GCATGATGGCATAATACAACCGG - Intergenic
1002081894 5:176742314-176742336 GCATGGGGTCATCAGGCACCAGG + Intergenic
1017584647 6:155907431-155907453 GCATGGGGTCCTAATCCAATGGG + Intergenic
1017945410 6:159092953-159092975 CCATGTGGTCATAATTCACAAGG + Intergenic
1018463682 6:164022830-164022852 GCATGAGGTCATATTTTGCCTGG + Intergenic
1018639697 6:165895218-165895240 GGATGAGGTCATACTCCATCAGG + Intronic
1029505924 7:100964114-100964136 GCATCAAGCCATCATCCACCGGG - Intronic
1030938508 7:115616240-115616262 GGGTGAGGTCCTAATCCAACAGG + Intergenic
1036209737 8:6832627-6832649 GCTTGAGGACAGAATCCACATGG + Intronic
1044574828 8:93756845-93756867 TCCTGAGCTCATGATCCACCAGG - Intronic
1045444670 8:102248254-102248276 GATAGAGGTCATAACCCACCAGG + Intergenic
1048071710 8:131028310-131028332 GTATCATGTCATAATTCACCTGG + Intronic
1051602926 9:18892385-18892407 CCAGGAGGTCACCATCCACCTGG - Exonic
1058514181 9:105752426-105752448 GCAGCAGGTCAGAACCCACCTGG + Intronic
1059280291 9:113127105-113127127 GCATGAGGACACAAGCCACAAGG - Intergenic
1186023356 X:5281756-5281778 GCATGAGGTCTTCATCCATGTGG - Intergenic
1186040348 X:5470291-5470313 AAATGAGGTAATAATCTACCAGG - Intergenic
1186858242 X:13646337-13646359 GCATGAGTTCATAAAACACCAGG - Intergenic