ID: 982201271

View in Genome Browser
Species Human (GRCh38)
Location 4:152963308-152963330
Sequence CTATAGGGCTGAAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982201262_982201271 0 Left 982201262 4:152963285-152963307 CCTGAGTTGTACTGCACCCAGGG 0: 1
1: 0
2: 2
3: 2
4: 74
Right 982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 185
982201260_982201271 13 Left 982201260 4:152963272-152963294 CCATTAGCAGATTCCTGAGTTGT 0: 1
1: 0
2: 2
3: 14
4: 195
Right 982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982201271 Original CRISPR CTATAGGGCTGAAGGGAAGT GGG Intronic
900860627 1:5226671-5226693 CTCTAGGGCTGAGGGGAGGTAGG + Intergenic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
901464213 1:9410760-9410782 CTATAGAGCTGTAGGGGAATGGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
903243841 1:22001608-22001630 ATATAGGGCAGAAGGTAAGCAGG - Intergenic
903573783 1:24325200-24325222 TTCTCTGGCTGAAGGGAAGTGGG + Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904900349 1:33852154-33852176 CGATAGGGGTGAAGGAGAGTGGG - Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
906716954 1:47977417-47977439 GTGTAGGGCTGAAGGAGAGTGGG + Intronic
906732112 1:48091804-48091826 CCCAAGGGCTGAAGGGAAGTTGG - Intergenic
909104664 1:71393198-71393220 CCCTAGGGCTCATGGGAAGTTGG + Intergenic
910278402 1:85472106-85472128 AAATAGGGCAGAAGGAAAGTTGG - Intronic
912393404 1:109320638-109320660 ATGTAGAGCTGAAAGGAAGTGGG - Intronic
913488167 1:119352989-119353011 CTATCTGGCTTAATGGAAGTTGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915252553 1:154600910-154600932 CTAAAAGGCAGAAGGGAAGGAGG + Intronic
916060033 1:161092031-161092053 ATACAGGGCTGAGGGGAAGGAGG - Intergenic
917388080 1:174499958-174499980 TTTTAGAGCTGAAGGGAATTTGG + Intronic
917537263 1:175883511-175883533 CTATGGGGCTAAAGGGATGAGGG - Intergenic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
920434656 1:205940078-205940100 CTGTAGGGTTTAAGGGGAGTAGG + Intronic
920746904 1:208637615-208637637 CCATAGGGGAGAAGGGAAGTGGG - Intergenic
921070909 1:211656876-211656898 CTATGGGGCTGATGGGAGGTGGG - Intergenic
921961572 1:221040742-221040764 CTTCAGGGCAGAAGGGATGTTGG + Intergenic
922782786 1:228266555-228266577 GTACAGTGCTGAATGGAAGTTGG - Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923616130 1:235539091-235539113 CTATAGTGCTGGAGTGGAGTAGG + Intergenic
1062779604 10:189980-190002 CTGTAGGGCTTAAGGGAAAGTGG + Intronic
1063031103 10:2235748-2235770 CTATAGTGCTGGAGTGGAGTAGG - Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1069688441 10:70334339-70334361 CCAGTGGGCTGAAGTGAAGTAGG + Intronic
1071281899 10:84111034-84111056 CTATTGGACTGAAGGGAACTAGG + Intergenic
1071970364 10:90899606-90899628 CAATATGGCTGATGTGAAGTAGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1075831524 10:125416017-125416039 CCATAGGGCTACAGGGAAGAAGG + Intergenic
1077107109 11:847071-847093 CTACAGGGCAGAGGGGCAGTCGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077609219 11:3634165-3634187 CCAAAGGGCTGCATGGAAGTGGG + Intergenic
1077743996 11:4880239-4880261 TTATGGGACTGAAGAGAAGTTGG + Intronic
1077973296 11:7219348-7219370 CTATAGGGGTGATGGCCAGTTGG - Intergenic
1080851428 11:36073517-36073539 CTACAGGGCTGTGGGGAAGGGGG - Intronic
1081160407 11:39741940-39741962 GTAGGGGGCTGAAGGGAAGGTGG + Intergenic
1085968211 11:81554835-81554857 CTATAGTGCTGGAGTGCAGTAGG - Intergenic
1087069072 11:94057664-94057686 GTAAAGGGCTGAAGAAAAGTGGG - Intronic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1088168565 11:106967927-106967949 CTAAAGTCCTGAAGAGAAGTAGG + Intronic
1088804308 11:113337905-113337927 ATCTAGGGTTGAAGAGAAGTTGG + Intronic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1090920027 11:131199002-131199024 CTGCAGGGCTGACAGGAAGTTGG + Intergenic
1091132890 11:133161167-133161189 CTTTGGGACTGAGGGGAAGTTGG + Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092931405 12:13319257-13319279 ATATGGAGCTGAAGTGAAGTTGG - Intergenic
1095046309 12:37511006-37511028 CTCTAGGTCTGAAGGGATGAAGG - Intergenic
1098786974 12:74771854-74771876 CTATAGGCATGAAGGAATGTTGG - Intergenic
1102015811 12:109647260-109647282 GTACTGGGCTGAAGGGAAGGAGG - Intergenic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102886742 12:116527802-116527824 GTAAAGGTCTGAAGGGAAGTCGG - Intergenic
1103767537 12:123291739-123291761 AAATAGAGCTGAAGGGAAGAGGG + Exonic
1104065868 12:125305354-125305376 CTAAAGTTCTGATGGGAAGTGGG + Intronic
1105601425 13:21891866-21891888 GCATAGGCCTGAAGGGAAGAGGG + Intergenic
1108785178 13:53891646-53891668 CTATAGTGCTAGAGTGAAGTAGG - Intergenic
1112785573 13:102947778-102947800 CTATAGGGCTGGAGGGTCCTGGG + Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113548349 13:111172465-111172487 CTCTAAGGCTGCAGGTAAGTTGG + Intronic
1115126511 14:30001279-30001301 CTATAAGGTTGAAGAGCAGTAGG - Intronic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116042960 14:39707929-39707951 CTAAAGGGTTAAAAGGAAGTAGG - Intergenic
1116548476 14:46202712-46202734 CAAGAGGGATGAAGAGAAGTTGG + Intergenic
1116994382 14:51307156-51307178 CTATAGGGATGAAGGAAGTTTGG - Intergenic
1117212682 14:53517429-53517451 TTATAGGACAGAAGGGAAGCAGG + Intergenic
1118527053 14:66657214-66657236 TTGTAGGGCTGAAGAGAATTCGG - Intronic
1119793207 14:77372582-77372604 CTCAAGGGCTGAAGAGAAATTGG - Intronic
1120412416 14:84174447-84174469 CTATAGTGCTGGAGTGGAGTAGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1122200306 14:100118637-100118659 CTATATGACTGATGGGGAGTGGG - Intronic
1126288794 15:47047529-47047551 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1126904135 15:53346378-53346400 CTATATAACTGAAGTGAAGTTGG - Intergenic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1130074683 15:80678604-80678626 GGATTGGGCAGAAGGGAAGTTGG - Intergenic
1130159562 15:81385212-81385234 CTGCAGGCCTGAAGGGAGGTGGG + Intergenic
1131212590 15:90510609-90510631 TTCTAGGCCTGAAGGGAATTGGG - Intergenic
1133855428 16:9545060-9545082 ATTTAGGGCTGATGGGAATTTGG - Intergenic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1137246879 16:46712866-46712888 CCATATGGCTGATGGGAAGTGGG - Intronic
1141709610 16:85690166-85690188 CTATGGGGCTTCAGGGAGGTTGG - Intronic
1151656430 17:75498393-75498415 CTCTAGGGCCGCAGGGAGGTAGG - Intronic
1152351327 17:79785473-79785495 CTCCAGGGCTGAAGGCAAGGTGG - Exonic
1153859364 18:9185334-9185356 CTTTTGGGATGAAGAGAAGTTGG + Intronic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1158725555 18:59968576-59968598 CTAGAGGGCTGTGGGGAAGGAGG + Intergenic
1163943531 19:20515977-20515999 CTATTGGACTGAAGGGGACTGGG - Intergenic
927326905 2:21815448-21815470 CTATAGGGCAAACGGGAATTTGG + Intergenic
927418364 2:22903369-22903391 CTTTAGGGCTGAATGGAAAGAGG + Intergenic
927890283 2:26743849-26743871 CTCTAGGTCTGAGGGGAAGGAGG - Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
931516122 2:63051600-63051622 CTCTAGGGCCGAAGGAAAATGGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
941402221 2:165044959-165044981 ATACAGGTCTGCAGGGAAGTGGG + Intergenic
944309589 2:198218541-198218563 CTCTAGGGCTAAAGGGAGGAGGG + Intronic
944590456 2:201212334-201212356 CTATAGTGCTAGAGTGAAGTAGG + Intronic
946394916 2:219438652-219438674 CTAAAGGGCAGAGGGGAAGCAGG + Intronic
947859695 2:233349807-233349829 GTATGGTGCTGAATGGAAGTAGG + Intergenic
948297815 2:236875992-236876014 TCAGAGGGCTGCAGGGAAGTGGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948948751 2:241235517-241235539 TTATTGGGCAGAAAGGAAGTGGG - Exonic
1168956262 20:1836543-1836565 CTACAGGGCTCAAAGGAAGAGGG - Intergenic
1169698967 20:8425281-8425303 CTATGCGGCAGATGGGAAGTTGG - Intronic
1169933951 20:10863207-10863229 CTATGAGGCTGAAGGGAGCTGGG - Intergenic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1171540877 20:25954607-25954629 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171800191 20:29605703-29605725 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1171843904 20:30251000-30251022 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1172083547 20:32360429-32360451 ATATAGGCCTGATGGGGAGTGGG + Intronic
1176260641 20:64177777-64177799 CCATGGGGCTGAGGGGAAGGTGG - Intronic
1179132997 21:38655642-38655664 CAATAAGCCTGAAGGGAATTTGG - Intronic
1179180873 21:39043886-39043908 CTCTAGGCCTGAGGGGAAGGGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1182429368 22:30290953-30290975 CCATGGGGCTGAGGGGAAGGAGG + Intronic
1184363259 22:44031280-44031302 CTCTTGGGCTGAGAGGAAGTGGG + Intronic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184716069 22:46282450-46282472 CTATTGGGCTCAAGGGAGATGGG + Intronic
950588570 3:13917050-13917072 CTAGAGGGTTGAGGGGAACTGGG + Intergenic
951008449 3:17647401-17647423 CTACAGGGAATAAGGGAAGTTGG + Intronic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
952528666 3:34240945-34240967 CTATAGTGCTCAATGGGAGTGGG - Intergenic
956760644 3:72440664-72440686 CTATAGGTAAAAAGGGAAGTGGG + Intronic
958484257 3:94683530-94683552 CTATAGAGTTGAATGGAAATAGG + Intergenic
959190416 3:103103772-103103794 CAATAGGGCTTAAGGGATATGGG + Intergenic
959596757 3:108137089-108137111 ACATAGAGCAGAAGGGAAGTGGG + Intergenic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
960804402 3:121569137-121569159 CTTTAGGGCTTAATGGAAGATGG + Intergenic
961810279 3:129518182-129518204 CTATAAGGCTGAGGGGATGTGGG - Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963222295 3:142825793-142825815 ATACAGGGCTGAAGGGCAGAGGG - Intronic
963778811 3:149466248-149466270 TTATAAGGCTGAAAGGAAGATGG + Intergenic
964522736 3:157585387-157585409 CTATTGGACTGAAGGGGACTGGG - Intronic
965414495 3:168375544-168375566 CTATAGAGCAGAAGGGATGGGGG + Intergenic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
969624534 4:8295567-8295589 CACTAGGGCTGAAGAGAAGGTGG - Intronic
969700910 4:8767068-8767090 CTTTACGGCTCAAGGGAAATTGG - Intergenic
972053479 4:34770186-34770208 GGATAGGGCTCAAGGGAATTAGG - Intergenic
973195300 4:47432917-47432939 CTGCAAGGCTGAGGGGAAGTGGG - Intergenic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
975860498 4:78671677-78671699 CTATAAGGCTGATGGGATATTGG - Intergenic
976995179 4:91422879-91422901 ATATAGGACTGAGAGGAAGTTGG + Intronic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
980030210 4:127819636-127819658 GGAGAGGGCTGAAGGGAAATGGG - Intronic
980205246 4:129711049-129711071 CCATAAGGCTCAGGGGAAGTAGG - Intergenic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
990239107 5:53799075-53799097 GTAATGGGCTGAAGGGAAGAGGG + Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991719115 5:69479404-69479426 CTATACTGATGAAGGGAAGAAGG + Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993983205 5:94567865-94567887 CTATGGGGCTTGAGTGAAGTAGG - Intronic
994083678 5:95735182-95735204 CAAGGGGGCAGAAGGGAAGTGGG - Intronic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
997924260 5:138013898-138013920 CTATAGGGGATAAGGGAAGATGG - Intronic
998449094 5:142220672-142220694 GAATTGGGCTGTAGGGAAGTCGG - Intergenic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
999242574 5:150136364-150136386 CTTTTGGGCTGGAGGGAACTGGG + Intronic
1000272724 5:159701975-159701997 CTCTAGTGGTGAAGGGGAGTGGG + Intergenic
1004108634 6:12691203-12691225 ATATAGGGCTAAAGGCAAATGGG + Intergenic
1004243847 6:13953422-13953444 CTATAGAGCAGGAGGTAAGTAGG + Intronic
1006785938 6:36667339-36667361 TTTCAGGGCTGCAGGGAAGTGGG + Intergenic
1007659368 6:43473882-43473904 CTATAGGGCTGCAGGTATGCAGG - Intergenic
1009686403 6:66963194-66963216 TAAAAGGGCTGAAGGGAACTAGG + Intergenic
1010490396 6:76469233-76469255 CTTGAGGGATGAAGAGAAGTAGG - Intergenic
1010640235 6:78316799-78316821 CTTTAGGGCTGCAGATAAGTTGG + Intergenic
1012579041 6:100841788-100841810 ATATAGGACTGAATGGCAGTAGG + Intronic
1014754460 6:125288044-125288066 GTTTAGTGCTGAAGAGAAGTAGG + Intronic
1018527269 6:164727084-164727106 AAATAGGGCTGAAGGGGGGTGGG - Intergenic
1021744622 7:23726255-23726277 CTAGAGGCCAGAAGGGATGTTGG + Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022395155 7:29981659-29981681 GTATGGGGCTGAAGGGAACTGGG - Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1024104108 7:46064066-46064088 CTATAGAGAGGAAGGTAAGTAGG - Intergenic
1027683166 7:81245843-81245865 CTCTAGGTGGGAAGGGAAGTGGG + Intergenic
1028096888 7:86771977-86771999 GGATAGGACTGAAGGAAAGTAGG - Intronic
1030674723 7:112372652-112372674 CTATAGTGCTGGAGTGGAGTAGG - Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031762562 7:125733215-125733237 GTAAAAGACTGAAGGGAAGTGGG + Intergenic
1033920645 7:146387382-146387404 CTCTAGGGCTGAAGGGGAGTAGG - Intronic
1042331437 8:67584655-67584677 CTATAGTGCTGGAGTGGAGTAGG + Intronic
1045043181 8:98246852-98246874 CTATGGGGCGGCAAGGAAGTGGG - Intronic
1045180063 8:99771049-99771071 CTCTAGGGGTGAAGGTAAGAGGG - Intronic
1049012410 8:139896121-139896143 TTACAGGGCTGAAAGGAAGTCGG - Intronic
1054164194 9:61704849-61704871 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1055020460 9:71663871-71663893 CTATAGGGGTGCAGGGGGGTGGG - Intergenic
1058007170 9:99929651-99929673 TTATATGGGGGAAGGGAAGTAGG - Intronic
1058470886 9:105277664-105277686 CAATAGGGCTGATGGGAGTTGGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1062330547 9:136041583-136041605 GTCTAGGGCTGAAGGGAATACGG + Intronic
1189787548 X:44572834-44572856 TTAGAGGACTGACGGGAAGTGGG + Intergenic
1193278264 X:79617322-79617344 TTAAATGGCTGCAGGGAAGTGGG + Intergenic
1195878969 X:109572962-109572984 CCAAAGGGAGGAAGGGAAGTAGG - Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic