ID: 982206240

View in Genome Browser
Species Human (GRCh38)
Location 4:152999184-152999206
Sequence CTGGTTCTCCAGGGCTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982206240_982206246 -9 Left 982206240 4:152999184-152999206 CCAGTTTAGCCCTGGAGAACCAG No data
Right 982206246 4:152999198-152999220 GAGAACCAGAGGTGGCAGGAAGG No data
982206240_982206249 1 Left 982206240 4:152999184-152999206 CCAGTTTAGCCCTGGAGAACCAG No data
Right 982206249 4:152999208-152999230 GGTGGCAGGAAGGAGTGGAGAGG No data
982206240_982206248 -4 Left 982206240 4:152999184-152999206 CCAGTTTAGCCCTGGAGAACCAG No data
Right 982206248 4:152999203-152999225 CCAGAGGTGGCAGGAAGGAGTGG No data
982206240_982206250 27 Left 982206240 4:152999184-152999206 CCAGTTTAGCCCTGGAGAACCAG No data
Right 982206250 4:152999234-152999256 TCCGCCTTCCCCTCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982206240 Original CRISPR CTGGTTCTCCAGGGCTAAAC TGG (reversed) Intergenic
No off target data available for this crispr