ID: 982207624

View in Genome Browser
Species Human (GRCh38)
Location 4:153008798-153008820
Sequence CTTGAGTTGCAGAGGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982207616_982207624 30 Left 982207616 4:153008745-153008767 CCAGGTGAGGGTTAAAACTGCAG No data
Right 982207624 4:153008798-153008820 CTTGAGTTGCAGAGGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982207624 Original CRISPR CTTGAGTTGCAGAGGAAATG GGG Intergenic
No off target data available for this crispr