ID: 982207932

View in Genome Browser
Species Human (GRCh38)
Location 4:153011148-153011170
Sequence ATGGAGGGGAAATGTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982207932_982207943 5 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data
982207932_982207937 -6 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207937 4:153011165-153011187 CTCCATGCTGCCCTTGTAGAGGG No data
982207932_982207945 24 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207945 4:153011195-153011217 GGGGGCTCCACCCCTTCAGCAGG No data
982207932_982207944 6 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207944 4:153011177-153011199 CTTGTAGAGGGCATCTTTGGGGG No data
982207932_982207939 3 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207939 4:153011174-153011196 GCCCTTGTAGAGGGCATCTTTGG No data
982207932_982207936 -7 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207936 4:153011164-153011186 CCTCCATGCTGCCCTTGTAGAGG No data
982207932_982207941 4 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207941 4:153011175-153011197 CCCTTGTAGAGGGCATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982207932 Original CRISPR ATGGAGGGGAAATGTGAGTT TGG (reversed) Intergenic
No off target data available for this crispr