ID: 982207933

View in Genome Browser
Species Human (GRCh38)
Location 4:153011162-153011184
Sequence TCTACAAGGGCAGCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982207933_982207944 -8 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207944 4:153011177-153011199 CTTGTAGAGGGCATCTTTGGGGG No data
982207933_982207943 -9 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data
982207933_982207951 22 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207951 4:153011207-153011229 CCTTCAGCAGGCTTCTGCCTGGG No data
982207933_982207949 21 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207949 4:153011206-153011228 CCCTTCAGCAGGCTTCTGCCTGG No data
982207933_982207941 -10 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207941 4:153011175-153011197 CCCTTGTAGAGGGCATCTTTGGG No data
982207933_982207945 10 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207945 4:153011195-153011217 GGGGGCTCCACCCCTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982207933 Original CRISPR TCTACAAGGGCAGCATGGAG GGG (reversed) Intergenic
No off target data available for this crispr