ID: 982207934

View in Genome Browser
Species Human (GRCh38)
Location 4:153011163-153011185
Sequence CTCTACAAGGGCAGCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982207934_982207949 20 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207949 4:153011206-153011228 CCCTTCAGCAGGCTTCTGCCTGG No data
982207934_982207951 21 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207951 4:153011207-153011229 CCTTCAGCAGGCTTCTGCCTGGG No data
982207934_982207945 9 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207945 4:153011195-153011217 GGGGGCTCCACCCCTTCAGCAGG No data
982207934_982207943 -10 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data
982207934_982207944 -9 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207944 4:153011177-153011199 CTTGTAGAGGGCATCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982207934 Original CRISPR CTCTACAAGGGCAGCATGGA GGG (reversed) Intergenic
No off target data available for this crispr