ID: 982207943

View in Genome Browser
Species Human (GRCh38)
Location 4:153011176-153011198
Sequence CCTTGTAGAGGGCATCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982207932_982207943 5 Left 982207932 4:153011148-153011170 CCAAACTCACATTTCCCCTCCAT No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data
982207933_982207943 -9 Left 982207933 4:153011162-153011184 CCCCTCCATGCTGCCCTTGTAGA No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data
982207934_982207943 -10 Left 982207934 4:153011163-153011185 CCCTCCATGCTGCCCTTGTAGAG No data
Right 982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982207943 Original CRISPR CCTTGTAGAGGGCATCTTTG GGG Intergenic
No off target data available for this crispr