ID: 982212965

View in Genome Browser
Species Human (GRCh38)
Location 4:153055835-153055857
Sequence ATAAACAATAGGAGGAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982212959_982212965 -5 Left 982212959 4:153055817-153055839 CCACAGTAAAATGAGACCATAAA No data
Right 982212965 4:153055835-153055857 ATAAACAATAGGAGGAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982212965 Original CRISPR ATAAACAATAGGAGGAGTAG GGG Intergenic
No off target data available for this crispr