ID: 982214501

View in Genome Browser
Species Human (GRCh38)
Location 4:153069022-153069044
Sequence CTCCAGCCACGTGGCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982214498_982214501 -1 Left 982214498 4:153069000-153069022 CCTTGTTCTGTCCATAAGTTCTC No data
Right 982214501 4:153069022-153069044 CTCCAGCCACGTGGCAGCGCTGG No data
982214497_982214501 20 Left 982214497 4:153068979-153069001 CCATTTTCTGCATCTCACTTTCC No data
Right 982214501 4:153069022-153069044 CTCCAGCCACGTGGCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982214501 Original CRISPR CTCCAGCCACGTGGCAGCGC TGG Intergenic
No off target data available for this crispr