ID: 982216189

View in Genome Browser
Species Human (GRCh38)
Location 4:153084582-153084604
Sequence ACTCTGAGATTAAACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982216189_982216195 5 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216195 4:153084610-153084632 AACGAGGCAGGCCTCTGCTGGGG No data
982216189_982216194 4 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216194 4:153084609-153084631 GAACGAGGCAGGCCTCTGCTGGG No data
982216189_982216196 8 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216196 4:153084613-153084635 GAGGCAGGCCTCTGCTGGGGTGG No data
982216189_982216193 3 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216193 4:153084608-153084630 AGAACGAGGCAGGCCTCTGCTGG No data
982216189_982216197 13 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216197 4:153084618-153084640 AGGCCTCTGCTGGGGTGGCCAGG No data
982216189_982216192 -7 Left 982216189 4:153084582-153084604 CCCTCAGGGTTTAATCTCAGAGT No data
Right 982216192 4:153084598-153084620 TCAGAGTGTGAGAACGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982216189 Original CRISPR ACTCTGAGATTAAACCCTGA GGG (reversed) Intergenic
No off target data available for this crispr