ID: 982219687

View in Genome Browser
Species Human (GRCh38)
Location 4:153113913-153113935
Sequence CCAGGCCACTTGGTGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982219676_982219687 28 Left 982219676 4:153113862-153113884 CCCGACCTGAACTCACTCCAGCA No data
Right 982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG No data
982219680_982219687 11 Left 982219680 4:153113879-153113901 CCAGCACAGGCGCTCTTGAGAGA No data
Right 982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG No data
982219677_982219687 27 Left 982219677 4:153113863-153113885 CCGACCTGAACTCACTCCAGCAC No data
Right 982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG No data
982219679_982219687 23 Left 982219679 4:153113867-153113889 CCTGAACTCACTCCAGCACAGGC No data
Right 982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG No data
982219675_982219687 29 Left 982219675 4:153113861-153113883 CCCCGACCTGAACTCACTCCAGC No data
Right 982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982219687 Original CRISPR CCAGGCCACTTGGTGCTCTG TGG Intergenic
No off target data available for this crispr