ID: 982220257

View in Genome Browser
Species Human (GRCh38)
Location 4:153118535-153118557
Sequence CCTGATCCAGACCCCAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982220257_982220263 14 Left 982220257 4:153118535-153118557 CCTCACTTGGGGTCTGGATCAGG No data
Right 982220263 4:153118572-153118594 ACTCTCTCATCTCAGCCTCCTGG No data
982220257_982220264 15 Left 982220257 4:153118535-153118557 CCTCACTTGGGGTCTGGATCAGG No data
Right 982220264 4:153118573-153118595 CTCTCTCATCTCAGCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982220257 Original CRISPR CCTGATCCAGACCCCAAGTG AGG (reversed) Intergenic
No off target data available for this crispr