ID: 982222511

View in Genome Browser
Species Human (GRCh38)
Location 4:153137101-153137123
Sequence TCCAGGGAACCGATTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222511_982222516 6 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG No data
982222511_982222519 23 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222519 4:153137147-153137169 GCCTGGTCCCATGTCAGCTATGG No data
982222511_982222522 27 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222511_982222521 26 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222521 4:153137150-153137172 TGGTCCCATGTCAGCTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222511 Original CRISPR TCCAGGGAACCGATTCCTCA TGG (reversed) Intergenic