ID: 982222512

View in Genome Browser
Species Human (GRCh38)
Location 4:153137117-153137139
Sequence GCAGAAGGAGTTGGGTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222512_982222516 -10 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG No data
982222512_982222522 11 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222512_982222521 10 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222521 4:153137150-153137172 TGGTCCCATGTCAGCTATGGTGG No data
982222512_982222519 7 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222519 4:153137147-153137169 GCCTGGTCCCATGTCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222512 Original CRISPR GCAGAAGGAGTTGGGTTCCA GGG (reversed) Intergenic