ID: 982222513

View in Genome Browser
Species Human (GRCh38)
Location 4:153137118-153137140
Sequence TGCAGAAGGAGTTGGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222513_982222522 10 Left 982222513 4:153137118-153137140 CCTGGAACCCAACTCCTTCTGCA No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222513_982222519 6 Left 982222513 4:153137118-153137140 CCTGGAACCCAACTCCTTCTGCA No data
Right 982222519 4:153137147-153137169 GCCTGGTCCCATGTCAGCTATGG No data
982222513_982222521 9 Left 982222513 4:153137118-153137140 CCTGGAACCCAACTCCTTCTGCA No data
Right 982222521 4:153137150-153137172 TGGTCCCATGTCAGCTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222513 Original CRISPR TGCAGAAGGAGTTGGGTTCC AGG (reversed) Intergenic