ID: 982222514

View in Genome Browser
Species Human (GRCh38)
Location 4:153137125-153137147
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222514_982222519 -1 Left 982222514 4:153137125-153137147 CCCAACTCCTTCTGCATCCAGTG No data
Right 982222519 4:153137147-153137169 GCCTGGTCCCATGTCAGCTATGG No data
982222514_982222522 3 Left 982222514 4:153137125-153137147 CCCAACTCCTTCTGCATCCAGTG No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222514_982222521 2 Left 982222514 4:153137125-153137147 CCCAACTCCTTCTGCATCCAGTG No data
Right 982222521 4:153137150-153137172 TGGTCCCATGTCAGCTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222514 Original CRISPR CACTGGATGCAGAAGGAGTT GGG (reversed) Intergenic