ID: 982222516

View in Genome Browser
Species Human (GRCh38)
Location 4:153137130-153137152
Sequence CTCCTTCTGCATCCAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222511_982222516 6 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG No data
982222508_982222516 17 Left 982222508 4:153137090-153137112 CCATTAAAGTACCATGAGGAATC No data
Right 982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG No data
982222512_982222516 -10 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222516 Original CRISPR CTCCTTCTGCATCCAGTGCC TGG Intergenic