ID: 982222517

View in Genome Browser
Species Human (GRCh38)
Location 4:153137132-153137154
Sequence GACCAGGCACTGGATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222517_982222526 27 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data
982222517_982222521 -5 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222521 4:153137150-153137172 TGGTCCCATGTCAGCTATGGTGG No data
982222517_982222522 -4 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222517_982222519 -8 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222519 4:153137147-153137169 GCCTGGTCCCATGTCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222517 Original CRISPR GACCAGGCACTGGATGCAGA AGG (reversed) Intergenic