ID: 982222522

View in Genome Browser
Species Human (GRCh38)
Location 4:153137151-153137173
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222513_982222522 10 Left 982222513 4:153137118-153137140 CCTGGAACCCAACTCCTTCTGCA No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222514_982222522 3 Left 982222514 4:153137125-153137147 CCCAACTCCTTCTGCATCCAGTG No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222512_982222522 11 Left 982222512 4:153137117-153137139 CCCTGGAACCCAACTCCTTCTGC No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222511_982222522 27 Left 982222511 4:153137101-153137123 CCATGAGGAATCGGTTCCCTGGA No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222515_982222522 2 Left 982222515 4:153137126-153137148 CCAACTCCTTCTGCATCCAGTGC No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data
982222517_982222522 -4 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr