ID: 982222526

View in Genome Browser
Species Human (GRCh38)
Location 4:153137182-153137204
Sequence CCTTACATCTGAGCAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982222520_982222526 11 Left 982222520 4:153137148-153137170 CCTGGTCCCATGTCAGCTATGGT No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data
982222517_982222526 27 Left 982222517 4:153137132-153137154 CCTTCTGCATCCAGTGCCTGGTC No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data
982222524_982222526 4 Left 982222524 4:153137155-153137177 CCATGTCAGCTATGGTGGGACAG No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data
982222518_982222526 17 Left 982222518 4:153137142-153137164 CCAGTGCCTGGTCCCATGTCAGC No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data
982222523_982222526 5 Left 982222523 4:153137154-153137176 CCCATGTCAGCTATGGTGGGACA No data
Right 982222526 4:153137182-153137204 CCTTACATCTGAGCAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982222526 Original CRISPR CCTTACATCTGAGCAGTGTC AGG Intergenic