ID: 982224768

View in Genome Browser
Species Human (GRCh38)
Location 4:153155402-153155424
Sequence AAGAATATGCAGAAATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982224765_982224768 -8 Left 982224765 4:153155387-153155409 CCACTGTACTTTAAAAAGAATAT 0: 1
1: 1
2: 8
3: 65
4: 616
Right 982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982224768 Original CRISPR AAGAATATGCAGAAATTGGA GGG Intronic
901822941 1:11841826-11841848 AAGAAAATGGGGAAAATGGAGGG - Exonic
902290161 1:15430093-15430115 TAGAATCTGCAGAAATTAGGAGG + Exonic
903425118 1:23247778-23247800 AAAAAAATGCAGAAATTAGCTGG + Intergenic
904915827 1:33970125-33970147 AAGAAAAGGCAGAAATTCAAAGG + Intronic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
906049137 1:42856250-42856272 AGGAATCTGCAGAAATTGTGTGG - Intergenic
906658003 1:47562648-47562670 AAGAATATGCATAAAAGAGATGG - Intergenic
907228707 1:52974781-52974803 AACACTTTGCAAAAATTGGATGG + Exonic
907229715 1:52984999-52985021 AAAAATATGCAAAAATTAGCCGG - Intronic
907298235 1:53469395-53469417 ATGAATCTCCAGAAATTGGTCGG + Intergenic
908126152 1:61032022-61032044 CAGAATATGTAGAAAAGGGACGG + Intronic
908519677 1:64929373-64929395 AAGAGTATCCTGAAATTGCAAGG + Intronic
909306677 1:74089379-74089401 AAAAATATCCATAAATTAGAAGG + Intronic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
910069427 1:83193873-83193895 AAGGCTATGCAGAAAATGGCAGG + Intergenic
910501645 1:87898866-87898888 AAGAAAATACAGGAAATGGAGGG - Intergenic
910699327 1:90056176-90056198 AATAAGATATAGAAATTGGAAGG + Intergenic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
910851477 1:91653584-91653606 AAGAAAATGCACATATTGGTGGG - Intergenic
910914407 1:92273908-92273930 ATGAATATTGAGAAATTGTATGG - Intronic
911353869 1:96791993-96792015 AAAAATATGAAGAAATTAGCTGG - Intronic
912152893 1:106881017-106881039 AAGACTTTGCAGATATTTGAAGG - Intergenic
912190716 1:107336981-107337003 AAGGACATGAAAAAATTGGAGGG + Intronic
912642272 1:111358903-111358925 AAAAATAGGAAGAAATGGGAGGG + Intergenic
912791116 1:112651957-112651979 AAGAAAATACAGAAATTAGCTGG + Intronic
913127791 1:115809311-115809333 AAGAAAATGCAGTAATTTTAAGG - Intergenic
915601990 1:156928133-156928155 AAGTCTGTGCAGAAATCGGAGGG - Intronic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
916737302 1:167619356-167619378 AAGAATATAAAGAAAGTAGATGG + Intergenic
917021797 1:170596749-170596771 AAAAAAATGCAAAAATTAGATGG - Intergenic
917643806 1:177009564-177009586 AAGAAGTTGCAGAAATAGAAGGG + Intronic
917759353 1:178139504-178139526 AAGAATATGGAGTAATAGTAAGG - Intronic
918018499 1:180661711-180661733 AAAAATATGCAAAAATTAGCTGG + Intronic
918672378 1:187235226-187235248 AAAAACATGCAGGAATTTGATGG + Intergenic
918691525 1:187486418-187486440 AAGAATATAAGGAAAGTGGATGG - Intergenic
918733897 1:188034248-188034270 AAAAAAATGCAAAAATTGTAAGG + Intergenic
918784153 1:188743254-188743276 GAGAACATGCAGTATTTGGAAGG + Intergenic
921306723 1:213804307-213804329 AAGAAATAGCAGAGATTGGAAGG - Intergenic
921866021 1:220088627-220088649 AAAAAAATGCAAAAATTAGATGG + Intronic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
921906182 1:220497650-220497672 TAGAATGTGCATAAATTGCAGGG - Intergenic
922505941 1:226125679-226125701 CAGAAGATGCAGGATTTGGACGG + Intergenic
922895499 1:229096991-229097013 AAAAATATCCAGAAAATGAATGG - Intergenic
923848419 1:237764341-237764363 AAGAATATGAACAGATGGGAGGG - Intronic
923907373 1:238400249-238400271 TAGAGCAGGCAGAAATTGGAAGG - Intergenic
924451815 1:244185240-244185262 CAGAATATACAGAACTTGGTTGG + Intergenic
1063216078 10:3926808-3926830 TAGAATATGCTGCAATGGGAGGG - Intergenic
1063735903 10:8754067-8754089 AAATGCATGCAGAAATTGGAGGG + Intergenic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1065532341 10:26685046-26685068 AAGAATATGCAAAAACATGAAGG - Intergenic
1066331300 10:34426383-34426405 AAGCACATGCAAAAAGTGGATGG - Intronic
1066437887 10:35410940-35410962 GAGAATATTGAGAAATTGGTTGG + Intronic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068030129 10:51696470-51696492 AAGACTATTGAGAAATAGGAAGG + Exonic
1068030165 10:51696903-51696925 AAGACTATTGAGAAATAGGAAGG + Exonic
1068205699 10:53849566-53849588 AAAAATATGTACAAATTGGCCGG + Intronic
1068321047 10:55416588-55416610 AAGCATATGGAGCAATTTGAAGG + Intronic
1068458829 10:57298948-57298970 AACAAAATGCATAAATTGGAAGG - Intergenic
1068587936 10:58821179-58821201 AAAAATATGCGGAAATTTTAAGG + Intronic
1068645903 10:59467284-59467306 CAGAATATGCAAAAACTGTAAGG + Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069351768 10:67534827-67534849 AGGAATTTGCAGAAATTTGGGGG + Intronic
1070405714 10:76092868-76092890 AAAAAAATGCATAAATTGAAAGG - Intronic
1071254807 10:83862534-83862556 AAGAAAATGCAGAAACTTGTGGG + Intergenic
1072408914 10:95183274-95183296 AAGAATATGCATAAAATGCCCGG + Intergenic
1072551655 10:96482690-96482712 ATGAACATGCAGAAATTTGGGGG + Intronic
1075563994 10:123490394-123490416 AAGAAAATGAAGAAACTGGGAGG - Intergenic
1075979919 10:126729295-126729317 GTGAATATGCAGTAATGGGATGG + Intergenic
1077723803 11:4653179-4653201 AAGAATAAGCAGATATGAGAAGG - Exonic
1078096993 11:8304810-8304832 AAGAATCAGCAGAAATAAGATGG + Intergenic
1078953143 11:16158252-16158274 GAGAAGGTACAGAAATTGGAAGG - Intronic
1080140305 11:28910428-28910450 AAAAAAATGAAGAATTTGGAGGG - Intergenic
1080618328 11:33965225-33965247 AAGGATGTGGAGAAATTGGTGGG + Intergenic
1080989068 11:37508206-37508228 AAGAAAATGCAGAAATTAGTTGG + Intergenic
1081888832 11:46523082-46523104 TAGAATCTGCAGAAATATGAGGG + Intronic
1082143129 11:48632995-48633017 GAAAATATGCAGACATTGCATGG + Intergenic
1082570326 11:54730357-54730379 GAAAATATGCAGACATTGCATGG + Intergenic
1083210576 11:61182630-61182652 AAGAAAATGCAAAAATTAGCTGG + Intergenic
1085657179 11:78326957-78326979 AAGGCTAAGAAGAAATTGGATGG + Intronic
1086602839 11:88656264-88656286 GAGAAGAGGGAGAAATTGGATGG - Intronic
1088364111 11:109020794-109020816 ACGAATAAACAGAAATTAGAGGG + Intergenic
1089591174 11:119541684-119541706 AAAAATTGGCAGAGATTGGAAGG + Intergenic
1091317897 11:134628295-134628317 AATAATATGCAGAAACAGTATGG - Intergenic
1094615258 12:32030473-32030495 AAAAAAATGCAAAAATTAGATGG + Intergenic
1094702362 12:32882008-32882030 GGGAATATGCAGAAAGGGGAAGG + Intronic
1095367631 12:41427049-41427071 AAACATTTGCAGAACTTGGATGG + Intronic
1095504180 12:42875370-42875392 AATCATATTCATAAATTGGAAGG - Intergenic
1095619504 12:44232712-44232734 ATCAATATTCAGAGATTGGAAGG - Intronic
1095722041 12:45411587-45411609 AGGAATATGGGGAAATGGGAAGG - Intronic
1095768369 12:45922478-45922500 AAGAATATAAAGAAATTGTACGG - Exonic
1095869097 12:47006049-47006071 AAGCCTATGGAAAAATTGGAAGG - Intergenic
1096162093 12:49387241-49387263 AAGAAGATGCTGAAAATGTAGGG + Intronic
1097446293 12:59676695-59676717 AACAAAATGCAAAAAATGGAGGG + Intronic
1097489869 12:60253510-60253532 AAGACTATGCAGTAATTAAAAGG - Intergenic
1097596299 12:61636381-61636403 AAAAAGAGGCAGATATTGGAGGG - Intergenic
1097995892 12:65887559-65887581 AAAAATATACAAAAATTGGCTGG + Intronic
1099603537 12:84772077-84772099 AAGAATCTGCAGTAATTGTGTGG - Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099753596 12:86810144-86810166 ATGAAAATGCAGAAATTTAATGG - Intronic
1100208857 12:92380502-92380524 GAGAAAATGCAGAAAGGGGATGG + Intergenic
1101154486 12:101914956-101914978 AAGAAAAGGAAGAAATTAGAGGG - Intronic
1101999356 12:109547137-109547159 AAGAAATTGAAGCAATTGGATGG + Intergenic
1103568000 12:121826761-121826783 AAGAATATGAGGAAGTGGGATGG + Intronic
1104349845 12:128035697-128035719 AAGAAAATGCAGAAAGGAGATGG + Intergenic
1104418031 12:128611635-128611657 CAGAATATGTAGATACTGGAGGG + Intronic
1104833025 12:131767387-131767409 AAGAATATGCAGAAATTCTTTGG + Intronic
1105066264 12:133201184-133201206 AAGAATATTCAGATACTGAAAGG - Intronic
1105287769 13:19020661-19020683 AAGGATGTGGAGAAACTGGAAGG + Intergenic
1105301130 13:19135647-19135669 AAGAGAATACAGAAATTGTATGG - Intergenic
1105777206 13:23674376-23674398 AAGAAAATGCACAATTTGTAGGG + Intronic
1106002630 13:25738490-25738512 AAAAATATGCTGTGATTGGAAGG + Intronic
1106503759 13:30354191-30354213 AATAATATGTAGAAATAGGCCGG + Intergenic
1107045820 13:35991060-35991082 GAGAAAAAGCAGAAATGGGATGG + Intronic
1107187098 13:37536320-37536342 AAGAATATGCAAAAGTATGAAGG + Intergenic
1107322439 13:39203906-39203928 AAGAAGAAACAGAAATTGGGAGG + Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107829544 13:44362235-44362257 AAGAATTGGCAGACATTGGTGGG + Intergenic
1108052616 13:46461135-46461157 AAGAAGATACTGAAATTGGACGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108920539 13:55668335-55668357 AAGAATATACAGAGATTTTAAGG - Intergenic
1109141993 13:58724583-58724605 AAGACTATCCACAAATAGGAAGG + Intergenic
1109155154 13:58900666-58900688 AAGAAGATGTATAAAATGGATGG + Intergenic
1109231672 13:59764967-59764989 AACAATATGTAGACATGGGAAGG - Intronic
1109303558 13:60614684-60614706 GAAAATATGAAGAAATTAGAGGG - Intergenic
1109538415 13:63742818-63742840 AAGAAGATACGGAGATTGGACGG - Intergenic
1109590775 13:64478139-64478161 AAAAATATGGGGAAACTGGAAGG - Intergenic
1109839190 13:67900952-67900974 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1110254492 13:73417622-73417644 AAGAATTTACAAAAATTGGCCGG + Intergenic
1110512701 13:76370089-76370111 AAGAATATGATGGAGTTGGAAGG - Intergenic
1111038326 13:82708301-82708323 AAGAATATGAACAGCTTGGAAGG + Intergenic
1111722663 13:91966021-91966043 AAGAATATGAAGAAAATTGCTGG - Intronic
1112483153 13:99795774-99795796 AAGACTATTCAAGAATTGGAGGG + Intronic
1112890581 13:104225404-104225426 TAGAATATGCATACATTTGAAGG - Intergenic
1113216098 13:108042392-108042414 CAGAATATAAAGAACTTGGAGGG - Intergenic
1113700325 13:112381329-112381351 AAAAAAATGCAGAAATTAGCAGG + Intronic
1114155881 14:20103082-20103104 AAAAATTTGCAGAAATTTTAAGG - Intergenic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1116494020 14:45538641-45538663 AAGAATATGGAGATATAGAAGGG - Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118285947 14:64472739-64472761 AGAAATATGCAGAAATCAGATGG + Exonic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1118648328 14:67862934-67862956 ATAAATATGCATATATTGGAGGG + Intronic
1119098413 14:71855913-71855935 CAGAGAATGAAGAAATTGGAAGG - Intergenic
1119412779 14:74444905-74444927 AAGAATATACTGAAATTAGAAGG - Intergenic
1119801437 14:77448678-77448700 AAAAAAATGAAGAAATGGGACGG + Intronic
1120127837 14:80767558-80767580 AAGAATATACAGGAAAAGGAAGG + Intronic
1120239435 14:81933022-81933044 GAGATCATGCAAAAATTGGAGGG + Intergenic
1120978063 14:90266910-90266932 AAGACTTTCCAGAAATGGGATGG - Intronic
1121838139 14:97110101-97110123 AAGAAAATGAAGAAAAGGGAAGG - Intergenic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1123456187 15:20428042-20428064 GAGAAAATGCTGAAAGTGGATGG - Intergenic
1123510172 15:20990997-20991019 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123567387 15:21564750-21564772 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123603651 15:22002043-22002065 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123635380 15:22302795-22302817 GAGAAAATGCTGAAAGTGGATGG + Intergenic
1123671059 15:22657902-22657924 TAGAAAGTGCAGAAATTGAACGG + Intergenic
1124067798 15:26362383-26362405 AACAATAAGCAGAAATTGATGGG + Intergenic
1124323103 15:28731131-28731153 CAGAAAGTGCAGAAATTGAACGG + Intronic
1124527000 15:30464280-30464302 CAGAAAGTGCAGAAATTGAACGG + Intergenic
1124771653 15:32543403-32543425 CAGAAAGTGCAGAAATTGAACGG - Intergenic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1125448215 15:39780975-39780997 GAAAATATGGATAAATTGGAAGG + Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1126363481 15:47870406-47870428 AAGATTTTGCAGGGATTGGATGG - Intergenic
1126881248 15:53100701-53100723 AAGAGTAGGGAGAAATAGGAAGG - Intergenic
1128699441 15:69793678-69793700 AAGAATAGGCAGAATTTGGGTGG - Intergenic
1128931022 15:71705049-71705071 AAGAATGGGTAGAATTTGGAAGG + Intronic
1128996561 15:72301151-72301173 AAAAATATGCAAAAATTAGCTGG - Intronic
1129032037 15:72626231-72626253 AGGAACATGCACAACTTGGACGG - Intergenic
1129134922 15:73539709-73539731 GACAATATGCAAAAATTGCATGG - Intronic
1129406807 15:75324970-75324992 AGGAACATGCACAACTTGGATGG - Intergenic
1129735007 15:77955297-77955319 AGGAACATGCACAACTTGGATGG + Intergenic
1130128655 15:81117122-81117144 AAGAATGTGCAGAAAATGCCTGG - Intronic
1130445763 15:84000100-84000122 AAGTATATGCAAAAACTGGTGGG - Intronic
1202975751 15_KI270727v1_random:291844-291866 AAGAATATGCAAAAATGGGTTGG - Intergenic
1133482734 16:6186839-6186861 CAGAATATGCAGAGAATGTAGGG + Intronic
1133678942 16:8102092-8102114 AACAATATGCATAAATAGAAGGG + Intergenic
1134356065 16:13483350-13483372 AACACTTTACAGAAATTGGAAGG + Intergenic
1134492287 16:14703902-14703924 AAGAATACGCAGAAAATGCCTGG - Intergenic
1134497668 16:14743024-14743046 AAGAATACGCAGAAAATGCCTGG - Intronic
1134617558 16:15663221-15663243 AAGAATATGAAAGAACTGGAAGG - Intronic
1134884804 16:17781125-17781147 AAGAATATGCAGTAATAGTCAGG - Intergenic
1135152625 16:20022209-20022231 AATAAAATGAAGAAATTGGTTGG - Intergenic
1135703311 16:24652365-24652387 AAGAAGATACAGAAATTATATGG + Intergenic
1136152935 16:28364332-28364354 AAGAATATGCAGAAAATTCCTGG + Intergenic
1136210148 16:28750941-28750963 AAGAATATGCAGAAAATTCCTGG - Intergenic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1136689373 16:32017910-32017932 TAGATTATGCAGAAATTTGTAGG - Intergenic
1136789965 16:32961452-32961474 TAGATTATGCAGAAATTTGTAGG - Intergenic
1136879847 16:33892484-33892506 TAGATTATGCAGAAATTTGTAGG + Intergenic
1137982622 16:53082784-53082806 AAGGATGTGCTGGAATTGGACGG - Intronic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138507047 16:57483652-57483674 AAAAAAATACAAAAATTGGAGGG + Intronic
1139559070 16:67730250-67730272 AAGAATATGGGGAAGATGGAGGG + Intronic
1139945482 16:70638559-70638581 AAGCATATGCAGATATTGGGAGG - Intronic
1140624483 16:76774747-76774769 AAGAATTGGGAGAAAATGGATGG + Intergenic
1140979468 16:80092966-80092988 AAGAATATCCAGACTTTGCATGG - Intergenic
1142336542 16:89492940-89492962 AAAAATATGCAAAAATTAGCTGG + Intronic
1203092168 16_KI270728v1_random:1222915-1222937 TAGATTATGCAGAAATTTGTAGG - Intergenic
1143049354 17:4111007-4111029 AAAAATATGCCGTAATTGGCTGG - Intronic
1143560291 17:7689685-7689707 TGGAATATGCAGAAATGGTAAGG + Exonic
1144589582 17:16512961-16512983 AAGAATATACAAAAATTAGCTGG - Intergenic
1144790765 17:17857596-17857618 GAGATTATGCAAAAATAGGAGGG + Intronic
1145321591 17:21770351-21770373 AAAAAAATGCAAAAATTAGACGG - Intergenic
1147846184 17:43405431-43405453 AAGAAAATGAAGAAACTGGCTGG + Intergenic
1148120729 17:45208989-45209011 ATGAATATGCAGCAATTGCTTGG - Intergenic
1148498968 17:48074547-48074569 TAGAATCTGCACAAATTGAAAGG + Intronic
1149287731 17:55184776-55184798 AACAATAGGCAAAAATTGAAGGG + Intergenic
1149356862 17:55848082-55848104 AAGAAAATGCAAAAATTAGCCGG - Intergenic
1150362180 17:64546097-64546119 AAGATTATTCGGAAATTGGTAGG - Intronic
1150590779 17:66560247-66560269 AAAAATATGAAGAAATTGTCAGG + Intronic
1150962511 17:69930003-69930025 TAGATGATGCAGAAATAGGAGGG + Intergenic
1151118717 17:71767976-71767998 AAAAATTTGCTGAAATTGAAAGG + Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153260417 18:3218323-3218345 AAGAATATGCTGAGTTTAGAAGG - Intronic
1153265592 18:3265867-3265889 AAGAACCTACAGAACTTGGATGG + Intronic
1153989555 18:10384456-10384478 AGGAAGGTGCAGAAATGGGAGGG - Intergenic
1154325315 18:13387001-13387023 AAGAAAATGCAGGACTTGCATGG - Intronic
1154928799 18:20970561-20970583 AAGAATATGATTAAGTTGGAAGG - Intronic
1155650823 18:28139397-28139419 AAGAAAAAGAAGAAATTGGGTGG - Intronic
1156240421 18:35248348-35248370 GAGAATATGGAAAAAATGGATGG + Exonic
1156611345 18:38728765-38728787 AAGAAAATGTAGAAATGGAAAGG - Intergenic
1156641873 18:39111355-39111377 AAAAATATTCAAAAATTGGGAGG + Intergenic
1157459562 18:47876214-47876236 AAGAATATCCTGAAGTTAGATGG - Intronic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158532059 18:58272473-58272495 AAAAAAATGCACAAATTGGCCGG + Intronic
1159232082 18:65621146-65621168 AAGAATATACATAAGTTGCAAGG - Intergenic
1159619766 18:70623606-70623628 AAGAGTATGCAGCACTTGCAGGG - Intergenic
1159817164 18:73089315-73089337 AAGGATGTGAAGAATTTGGATGG - Intergenic
1160050330 18:75427477-75427499 AAGACTCTGCAGGAATGGGACGG - Exonic
1160238573 18:77105819-77105841 AAGAATCTGCAGAATTTGTAGGG + Intronic
1160964286 19:1739210-1739232 GTGAAAATGCAGAAACTGGATGG + Intergenic
1161508432 19:4657063-4657085 AAGAAGATGCAAAAATTAGCCGG + Intronic
1162330138 19:10023020-10023042 AAGAATATACAAAAGTTGGCCGG - Intergenic
1163358127 19:16828314-16828336 AAGAAAATGAAAAAATTGGCTGG - Intergenic
1165976987 19:39684824-39684846 AAAAACATGCAGAAATTAGCTGG - Intergenic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
926479684 2:13377123-13377145 GAGAAAATGCTGAAAGTGGATGG + Intergenic
927395380 2:22644345-22644367 AAAAAGTGGCAGAAATTGGAAGG + Intergenic
927752578 2:25682723-25682745 AAGAAAATGCAAAAATTAGCTGG - Intergenic
927960332 2:27237327-27237349 AGGAAGATTCAGAAATAGGAAGG - Intronic
928753762 2:34499986-34500008 AAGGATATGCAGTAATTGCCTGG + Intergenic
929260413 2:39861062-39861084 AACAACATGCAGAACATGGAAGG + Intergenic
929296662 2:40256096-40256118 AAGATTATGCAGATATTGCCAGG - Intronic
929406398 2:41647744-41647766 AAGAAAATGTAGATAGTGGATGG - Intergenic
929500261 2:42484607-42484629 AAGAATACCCAGAAACTGGGTGG + Intronic
930262528 2:49164387-49164409 CAGAGTAAGCAGAAATTGAAGGG + Intergenic
931156785 2:59641742-59641764 ATGAATCTAAAGAAATTGGAGGG - Intergenic
932329021 2:70887056-70887078 AAGAATATCAAGTAATTGAACGG + Intergenic
933316709 2:80724111-80724133 GACAATATGCAGAACTTGAATGG - Intergenic
933479420 2:82836713-82836735 AATAATATTCAGAAAATGCAAGG - Intergenic
933606185 2:84386655-84386677 AAGAATTAGCACAAATAGGAGGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
935678247 2:105614709-105614731 AAGAATATGCAAAAACAGGCTGG + Intergenic
935816597 2:106852130-106852152 AAGAATGGGCAGAAACTAGAGGG - Intronic
936041892 2:109156122-109156144 CAGACAATGCAGAAATTGGGAGG - Intronic
936109550 2:109653695-109653717 AAGAATATGAGAAAATTGAAAGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
936949127 2:117959532-117959554 GAGAATGAGGAGAAATTGGATGG + Intronic
937292514 2:120790280-120790302 AAGATTATCCAGAAACTTGAAGG - Intronic
937839808 2:126513714-126513736 AAAAATAAGCAGAAATTTCATGG + Intergenic
937972679 2:127562780-127562802 AAAAAAATGCAAAAATTGGCTGG - Intronic
938585018 2:132681923-132681945 AGGAACATGCTGATATTGGAGGG + Intronic
939167315 2:138653648-138653670 AAAAATATGCAGAATGTAGATGG + Intergenic
939204588 2:139084056-139084078 AAGAATAAGTACAAATTTGAGGG + Intergenic
939435124 2:142166158-142166180 CAGAATAGGCAGAAAATGCAAGG + Intergenic
939728702 2:145754874-145754896 AAGAAAAGGCAGAAAATGGATGG - Intergenic
939874192 2:147557709-147557731 AAGCATGTGTAGAAACTGGAAGG - Intergenic
941052983 2:160756296-160756318 AAGCATATGTAAAAATTGCAAGG + Intergenic
941182227 2:162273372-162273394 AAGAAAATGCAGAAACAGCAGGG + Intronic
941366258 2:164615133-164615155 AAGAGTATGCAAAAACTGGAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
943366100 2:186968952-186968974 AAGCATATGCACAGACTGGATGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944456189 2:199897288-199897310 AATAAAATGAAGAATTTGGAAGG - Intergenic
945430681 2:209760359-209760381 AAGAAGATGTACATATTGGAAGG + Intergenic
946465692 2:219910019-219910041 AAGAATATGTGGTATTTGGATGG + Intergenic
946817831 2:223597465-223597487 AAGAAAAGGCAGAAAAGGGAAGG - Exonic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
947775433 2:232705153-232705175 AAAAATATCCAGAAGTTGGCCGG - Intronic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1169565365 20:6847935-6847957 AAGGATGTGGAGAAATAGGAAGG - Intergenic
1169871324 20:10251482-10251504 AAGAAATAGCAGACATTGGAAGG + Intronic
1170740144 20:19048966-19048988 AGGAATATGAAGAAAAGGGAGGG + Intergenic
1170935653 20:20806613-20806635 GAGAATTTGCAGAAATGTGATGG + Intergenic
1171491575 20:25522854-25522876 AAGATCATGCAGAGATGGGATGG - Intronic
1172471407 20:35199585-35199607 ATAAAAATGCAGAAATTGGCCGG + Intergenic
1173939639 20:46899251-46899273 AGGAAGATGCTGAATTTGGATGG + Intronic
1174871070 20:54182870-54182892 AAGAATATTCATAACTTGTAGGG + Intergenic
1175037574 20:56014841-56014863 AAGAATCTGCAGACGTAGGAAGG - Intergenic
1175143389 20:56877626-56877648 AAAACTAGGCAGAAACTGGAAGG - Intergenic
1176077704 20:63255760-63255782 AAGAATATTCAGGAATCAGATGG + Intronic
1177046416 21:16175699-16175721 CAGAATTTTCAGAAATTTGAAGG - Intergenic
1179185691 21:39083701-39083723 AAGAAGTTCCAGAAACTGGAGGG - Intergenic
1181919914 22:26312591-26312613 AAGAATATGGGGAAACTGGCAGG - Intronic
1182761683 22:32727323-32727345 AATAATATGCAGCAATTAAAAGG - Intronic
1182806328 22:33073663-33073685 AAGAATATGAAGAATGTGAATGG - Intergenic
1183278439 22:36917383-36917405 AAGCTTATGAAGAAATTGAATGG - Intronic
1184079146 22:42205931-42205953 AAAAATATGCAAAAATTAGCTGG - Intronic
1184716588 22:46286082-46286104 AAGAATGTTCTGAAAATGGAGGG - Intronic
949204491 3:1421651-1421673 AGGAAAAGGCAGAAATTGTAAGG - Intergenic
951172615 3:19559425-19559447 AAGTAAATGCAGAAAGTGGTGGG + Intergenic
951190758 3:19768248-19768270 GAGAATGTGGAGAAATTGGAAGG + Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
955372898 3:58368877-58368899 AAGAATGTGTAGACAATGGAAGG + Intronic
955684776 3:61538957-61538979 AAAAAAATACAGAAATTAGACGG - Intergenic
956301425 3:67776235-67776257 AAGGATGTGGAGAAATAGGAAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956664466 3:71629715-71629737 GACAATAAGCAGAAATTGCAAGG + Intergenic
956876067 3:73464562-73464584 AACAAGATACAGAAACTGGAAGG - Intronic
956975328 3:74572448-74572470 AATACTATGCAGAAATTAAAAGG + Intergenic
959520966 3:107322465-107322487 AAGAATGTTAAGAACTTGGATGG - Intergenic
960105175 3:113788079-113788101 AAAAATATTTAGAAATTAGAAGG - Intronic
960964859 3:123097698-123097720 AAGGACATGAAGAAAATGGAGGG - Intronic
961258715 3:125581812-125581834 AAAAAAATACAGAAATTAGATGG + Intronic
962081678 3:132145875-132145897 AAGAAATTACAGAAATTGAAAGG + Intronic
962280037 3:134044812-134044834 AAGAATATGCATAAAATGCCTGG + Intronic
962559026 3:136586935-136586957 AAGAAGAGCCAGAAAATGGAGGG + Intronic
963017244 3:140837579-140837601 AAAGATATGGAGAAATTGGCCGG + Intergenic
963156614 3:142105081-142105103 CAGAATATGTATAAACTGGAGGG - Intronic
963157811 3:142117934-142117956 AAAAATATACAGAAATTAGCCGG + Intronic
963353155 3:144177174-144177196 AAGAATATAAAGAAACAGGAAGG - Intergenic
965084009 3:164070728-164070750 AAGAATATCAAGAAATGTGAAGG + Intergenic
965119510 3:164534466-164534488 AATAACATGCAGACATTGGCTGG + Intergenic
966156289 3:176920069-176920091 AAGAAAATCCAGAAATTGGGGGG + Intergenic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967326583 3:188246576-188246598 TAGAAAATGTAGAAACTGGAAGG - Intronic
967612323 3:191521898-191521920 GAGAATATGCAGAAACTATATGG + Intergenic
968604738 4:1529227-1529249 AGGAAAATGCTGAGATTGGATGG - Intergenic
969882193 4:10184123-10184145 AAGAATATGTGGAAATAGTATGG + Intergenic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
971401593 4:26280872-26280894 AAGAATATTTTGAAATTGAAAGG + Intronic
972462927 4:39322921-39322943 AAAAATATACAAAAATTAGATGG + Intronic
972479768 4:39486261-39486283 CAGAAGCTGCAGAAATTAGAAGG + Intergenic
973582429 4:52357597-52357619 AACATGATGCAGAAGTTGGAGGG + Intergenic
975042146 4:69759361-69759383 AAGAGTATTTACAAATTGGAAGG + Intronic
975074589 4:70189801-70189823 CAGAAAATCCAGAAATTGGGAGG + Intergenic
975156923 4:71082451-71082473 AAGAACATGCAGCAATTTGGTGG - Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975302300 4:72804553-72804575 AATAATATTCATAAATTGAAAGG + Intergenic
976237910 4:82920349-82920371 GTGAATATTCAAAAATTGGAAGG + Intronic
976578431 4:86704524-86704546 AAGCATATGTAGAAATAAGATGG - Intronic
977086920 4:92611665-92611687 AAAAATGTGAAGAAATTGGTGGG - Intronic
977234699 4:94494310-94494332 AAAAATATACAGAAATTTCAAGG - Intronic
977522029 4:98096803-98096825 ATGAATTTGCAGAAATTCAAAGG + Intronic
977632218 4:99255646-99255668 AAGGATGTGGAGAAATAGGAAGG - Intergenic
978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG + Intergenic
978724559 4:111955348-111955370 AAGAGTGTGCAAAAATTGAAGGG - Intergenic
978790254 4:112655873-112655895 AAGAAAATGCAGAGACCGGAAGG + Intronic
979515046 4:121598090-121598112 CAGAATATGCAAATATTGGGAGG - Intergenic
980203744 4:129690599-129690621 AAGAATATGCAAAATATGGTAGG - Intergenic
980713383 4:136599986-136600008 AAGAATGTGTAGAAAAGGGAAGG + Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981762416 4:148208944-148208966 AAGAATATGCAAAAAATGGCCGG + Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982706463 4:158715296-158715318 AAAAATATGCAGAAGTTTTAAGG - Exonic
982911407 4:161147545-161147567 AGCCATATGAAGAAATTGGAGGG + Intergenic
982912427 4:161161203-161161225 AAGAATATGCAGGAATAGACAGG + Intergenic
983231149 4:165130070-165130092 TACAATATGCAGAAGTGGGAGGG - Intronic
983319083 4:166172421-166172443 ACAAAAATGCAGAAACTGGAAGG - Intergenic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
983877240 4:172892077-172892099 AATAAAATCCAGAATTTGGATGG - Intronic
983922525 4:173361379-173361401 AAAAATATGAAGAAATTCTAGGG + Intergenic
984033208 4:174630924-174630946 TAGATTATTCTGAAATTGGAGGG + Intergenic
984222668 4:176996698-176996720 AAGAATATGCATAAATATTAAGG - Intergenic
984388611 4:179097835-179097857 AAGAATATGCACAAATAAGATGG + Intergenic
984906841 4:184636267-184636289 AAGAAAATACAGAAATTAGCTGG - Intronic
985336932 4:188905806-188905828 AAGAAAATACAGAAATTAGCTGG - Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986689329 5:10301223-10301245 AAGAATATTCAGTAATGTGAAGG - Intronic
986746015 5:10745932-10745954 AAGAATGCTCAGAAAATGGAAGG + Intronic
986889419 5:12283468-12283490 ATAAATATGCAGAAATAAGATGG - Intergenic
986898335 5:12399135-12399157 ATAAATATGCTGAAATGGGATGG - Intergenic
987459338 5:18189352-18189374 AAGAATGTGCTGCTATTGGATGG + Intergenic
988019868 5:25608691-25608713 TAGGAGATGCACAAATTGGAAGG - Intergenic
988862679 5:35300920-35300942 AAGAAAATGTAGAAACTAGAAGG - Intergenic
988908235 5:35811944-35811966 AAAAATATGGAGAAATTAGTCGG - Intronic
989172634 5:38487958-38487980 AAGAAGATTCAGAAATTTGTGGG - Intronic
989304572 5:39938442-39938464 AAAAAAGTGCAGAATTTGGAAGG + Intergenic
990361772 5:55028008-55028030 AAGGATATCTAGAAATTGAAAGG + Intronic
990583582 5:57188579-57188601 AAAAAAATGCAGAAATTAGCTGG + Intronic
991985864 5:72286296-72286318 AAGAACATGCAAAAGTTGAAGGG + Intronic
992936355 5:81710802-81710824 AGGAATAGGCAAAAATTGGCAGG + Intronic
993403341 5:87480287-87480309 AAGAAAAGTCAGAAATAGGAAGG - Intergenic
993501344 5:88671306-88671328 CAAAATATGCAGAATCTGGAGGG + Intergenic
993795039 5:92256520-92256542 GAAAATAGGCAGAAATTGAATGG + Intergenic
994386638 5:99141403-99141425 ACTAATATGCACAAATTAGATGG - Intergenic
994638730 5:102377831-102377853 AAAAATATGCAAAAATTAGCTGG - Intronic
995167154 5:109057439-109057461 CAGAATATTCAGATATTAGAAGG + Intronic
995178918 5:109212005-109212027 AAGGATATCCAGGAATTGAATGG - Intergenic
995294095 5:110498562-110498584 AAAAGTAGGCAGAAATTGAAGGG + Intronic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
997910192 5:137863970-137863992 AAAAATATGCAAAAATTAGCTGG + Intergenic
998729625 5:145060054-145060076 AATAATATGCAGACATTAAAAGG - Intergenic
998769673 5:145527915-145527937 AAGAAGCTGGAGAGATTGGAAGG - Intronic
998991906 5:147826453-147826475 AAGAATAAGCAGAAACTCGGAGG + Intronic
999182515 5:149680274-149680296 AAGAATGTGCATAAAATGGCTGG - Intergenic
999547895 5:152651051-152651073 AGGAAAATGGAGAAAGTGGAGGG - Intergenic
1001149907 5:169218178-169218200 AAGAATATGGGGACATTTGAAGG - Intronic
1001389952 5:171370799-171370821 AAGAATATTCAGCATTTGGCCGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003471930 6:6444514-6444536 AAGGATGTGGAGAAATTGGAAGG + Intergenic
1004698444 6:18056050-18056072 AAGAAGCCGCAGAAGTTGGAGGG - Intergenic
1004821273 6:19370707-19370729 AAGAATAGGAACAAAATGGAGGG + Intergenic
1005049091 6:21666962-21666984 ATGAATATGCAGAAATTGAGAGG + Intergenic
1005232945 6:23725369-23725391 GAGAATATCCAGAAATTTCATGG + Intergenic
1005318469 6:24627960-24627982 TAGAATAAGCAGTATTTGGAAGG - Intronic
1005692170 6:28317952-28317974 AAGAATGTGCTGTAATTGGAAGG - Intergenic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009581915 6:65547151-65547173 AAGAATATGCATACAGTGGCAGG - Intronic
1010303500 6:74288807-74288829 AAGAAAAAGCAGAAACTGAATGG - Intergenic
1010739831 6:79487731-79487753 CAGAATATGGATAAATTGCAAGG - Exonic
1011802346 6:91031417-91031439 AAGAATATACTTAAAGTGGAGGG - Intergenic
1011977071 6:93315392-93315414 AAGAATATGCAGCAGTTGCGTGG + Intronic
1012056770 6:94422515-94422537 AAAAATGTGCAGTAATTGAATGG - Intergenic
1012262172 6:97100339-97100361 AAGGATATACATAAATTTGATGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013612569 6:111808533-111808555 AAGAATGTCCAGAGACTGGAGGG - Intronic
1013742328 6:113301767-113301789 AAGAACATGCAGAATTTTGCAGG + Intergenic
1014420491 6:121238314-121238336 AAAAATAGGCAGAAAATAGAGGG - Intronic
1014539048 6:122651856-122651878 AAGAGTATGATGAAATTGGCAGG - Intronic
1015183980 6:130392369-130392391 AAGAAAATGTAGAAACTTGATGG - Intronic
1015463791 6:133524444-133524466 AAGAATATGTAGAAATTCCACGG + Intronic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1016624908 6:146155741-146155763 ATGAAGTTGGAGAAATTGGAAGG - Intronic
1016679299 6:146809500-146809522 AAAAAAATACAGAAATTGGCCGG - Intronic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017785174 6:157750974-157750996 GAGGATGTGAAGAAATTGGAAGG + Intronic
1017941698 6:159058775-159058797 AAGATTCTGAAGCAATTGGACGG - Intergenic
1018223572 6:161606192-161606214 AAGAACAGGCTGATATTGGAAGG + Intronic
1018281327 6:162188560-162188582 AAGAAGATCCTGAAATTAGAAGG - Intronic
1018330261 6:162719959-162719981 AATAAAATGGAGAAATAGGAAGG - Intronic
1018359144 6:163048155-163048177 AAGTACATGCAAAGATTGGAAGG - Intronic
1018543193 6:164906615-164906637 AAGAATATGTAGAAATTTATTGG - Intergenic
1019088899 6:169507927-169507949 AAGTACATGCAGCAGTTGGAAGG - Intronic
1020581276 7:10005270-10005292 AAGATTATGCACCAATTGAACGG + Intergenic
1021276556 7:18658728-18658750 AACAACATGCAGAGCTTGGAGGG - Intronic
1021501811 7:21339977-21339999 AAGGATGTGGAGAAATAGGAAGG - Intergenic
1021833098 7:24638302-24638324 AAGAAAATACAGAAATTGAAGGG - Intronic
1021833156 7:24638625-24638647 TAGAAAATACAGAAATTGGCCGG - Intronic
1021981794 7:26062521-26062543 AAGAAGAGGGAGAAATTGGTAGG + Intergenic
1022022279 7:26412377-26412399 AATAGTATGCAGCCATTGGAGGG - Intergenic
1022879892 7:34575780-34575802 AAGAATGTGGAGAAATTTGGGGG + Intergenic
1023126169 7:36956362-36956384 AGGCATATGCAGAATTTGAAGGG - Intronic
1023765573 7:43507423-43507445 AAGGACATTAAGAAATTGGAAGG + Intronic
1024826266 7:53394165-53394187 AAGAATATGAAAAAATTAGCCGG + Intergenic
1026130894 7:67620095-67620117 AAGATAATGAAGAATTTGGAAGG - Intergenic
1026439372 7:70430652-70430674 AAGAATATGCAGAAAAGGAAGGG + Intronic
1027287207 7:76659052-76659074 AAGGCTATGCAGAAAATGGCAGG + Intergenic
1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG + Intergenic
1028387686 7:90275966-90275988 AAGAGTAAGCAGACACTGGAAGG - Intronic
1028574816 7:92336816-92336838 AAAAGCAGGCAGAAATTGGAGGG - Intronic
1028702670 7:93799708-93799730 TAGAATATGGAGAGATTGGAAGG + Intronic
1028778827 7:94711683-94711705 AAGCATATGCTAAAATTGCAAGG - Intergenic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1029895644 7:103980872-103980894 AGGAATATGAGGAAATTGGTTGG - Intronic
1030579068 7:111329746-111329768 AAGAAAATTTAAAAATTGGAAGG + Intronic
1030645035 7:112051375-112051397 ATGTATATGCAGAAATTTTAAGG - Intronic
1030714007 7:112788026-112788048 AAGAATATGCAGGATATGGCCGG - Intronic
1031833546 7:126655060-126655082 AAGAACATACATAAAATGGATGG + Intronic
1032731473 7:134647209-134647231 AAGAATATATAGAAGTTGGAGGG + Intronic
1032824601 7:135556866-135556888 AAGAATATCCAGAACTGGCAGGG - Intergenic
1033163755 7:139020313-139020335 AAAAATAATCAGAAATTGGCTGG + Intergenic
1033781233 7:144671722-144671744 GGGAATATGCAGGAATTGGGAGG - Intronic
1035576330 8:709016-709038 AAGAATATTCTGGAATTAGATGG + Intronic
1036143475 8:6229404-6229426 ATGAGTATACAGAGATTGGAGGG - Intergenic
1036445555 8:8819307-8819329 AAGAATATCCAAGAATTGGCCGG + Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036606862 8:10314796-10314818 ATGAAAATGAAGAAAATGGAAGG + Intronic
1037046787 8:14315443-14315465 AAGATTATGAAGCAAATGGAAGG + Intronic
1037118547 8:15255103-15255125 AAAATTATCCAGATATTGGAAGG - Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037490941 8:19396620-19396642 AAGATTATACAGAAAATGGTAGG - Intergenic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1037927838 8:22858539-22858561 AAGAATATTGAGAAAATGAATGG - Intronic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038801839 8:30756439-30756461 AAAAAAATGCAAAAATTGGCCGG - Intronic
1038861190 8:31390660-31390682 AAGAATTTCCTGAAAATGGAAGG + Intergenic
1040603306 8:48905588-48905610 AAGACTATGTAGGAATTAGATGG + Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041407498 8:57516226-57516248 AAGAAAATGCAGAAATGAGAAGG - Intergenic
1042264376 8:66893210-66893232 AAGAGAATGCAGAAATTAGCTGG + Intronic
1042363434 8:67908681-67908703 AAGAAAATCCTGAAAATGGAAGG + Intergenic
1042745550 8:72102448-72102470 AAGAAACTGCAGAAAATAGAAGG - Intronic
1043321539 8:78993195-78993217 AAGGATATGGAGAAATTGATTGG + Intergenic
1045359197 8:101416427-101416449 AAAAAAATGCAAAAATTGGCTGG + Intergenic
1046338149 8:112817202-112817224 AAGAAAATGCAGAAAAATGAAGG + Intronic
1046647516 8:116802222-116802244 TAGGATATGGAGATATTGGAGGG + Intronic
1047688834 8:127330032-127330054 AAGAATAATTAGAAGTTGGATGG + Intergenic
1048947794 8:139466272-139466294 CAGAGTATGCAGACATTGTATGG + Intergenic
1050212475 9:3277435-3277457 AAGCCTATGCAGAAAGTGGATGG - Exonic
1050628323 9:7532232-7532254 AAGAACATGAGGCAATTGGAAGG + Intergenic
1051155090 9:14133994-14134016 AAGAAAATGGAGAAATTGAGAGG - Intronic
1051638702 9:19204537-19204559 AAAAATATACAGAAATTAGGCGG - Intergenic
1051655293 9:19375313-19375335 AATAATATGCAGAACTTAAAAGG - Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052794195 9:32908019-32908041 AAAAATATCCAGAATTTGAAAGG + Intergenic
1052914247 9:33912077-33912099 AAGAATATGCTGAAATTATTAGG + Exonic
1053490869 9:38500908-38500930 AAGAAAATGCAAAAATTAGCTGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1055038323 9:71841820-71841842 AAGAAAATGCAGATCTGGGACGG - Intergenic
1055211368 9:73798110-73798132 AAGAAGAAGTAGAAATTGAAAGG - Intergenic
1055252642 9:74326780-74326802 AAGAATGAGCAGAGAATGGATGG - Intergenic
1055659183 9:78484871-78484893 AAAAAAATGCATAAATTGAAAGG - Intergenic
1055871152 9:80881444-80881466 CAGCATATGCAGAAATTGTGCGG - Intergenic
1055943844 9:81675103-81675125 AATAATATGGGGAATTTGGAAGG - Intronic
1056082181 9:83106829-83106851 ATGAAAATGAAGAAATTAGAAGG - Intergenic
1056844668 9:90026773-90026795 GAGAATTTGCAGAAATAGGCTGG - Intergenic
1058888803 9:109343417-109343439 AAGAGGATGCAGAAATTAGAGGG + Intergenic
1058999113 9:110329904-110329926 AAGTATTTGCAGGAAATGGAAGG + Intronic
1059623428 9:116034645-116034667 AAAAAAATGCAGAATTTGGAGGG - Intergenic
1059640037 9:116207481-116207503 AAGAACATTCTTAAATTGGATGG + Exonic
1185883960 X:3765228-3765250 CAGATTTTGCAGAAATTGCAAGG - Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186361170 X:8843633-8843655 AAGAATCTGCAAAAGTTGCATGG + Intergenic
1186362866 X:8861083-8861105 AGGAATATTCAGAAGTTGGCAGG + Intergenic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1188043176 X:25394241-25394263 AAGAATATCAACAAATTGAAAGG - Intergenic
1188294754 X:28433636-28433658 ATGTAAATGCAGAAATTGGGTGG - Intergenic
1188304442 X:28545448-28545470 AAGAATGTGCAGAAATTTCGTGG + Intergenic
1188357222 X:29206791-29206813 AAAAAAATGTAAAAATTGGAAGG + Intronic
1188740172 X:33768859-33768881 AAGAATATAGATAAATTGTATGG - Intergenic
1188758042 X:33988120-33988142 ACGAAGATTCAGAAACTGGATGG + Intergenic
1188981272 X:36729363-36729385 AGGAATATGCAGGAAATGCATGG - Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189455278 X:41182211-41182233 AAAAATATGCAAAAATTAGCTGG + Intronic
1189619341 X:42818827-42818849 GAGAATATGCTGAAAGTCGAAGG + Intergenic
1190278309 X:48913344-48913366 AAGAATCTGCAAAAGTTGGAGGG + Exonic
1191090966 X:56620835-56620857 GAGAATATGAAGAGATGGGATGG + Intergenic
1192354587 X:70388901-70388923 AAAAATATCAATAAATTGGATGG - Intronic
1192567335 X:72176147-72176169 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1193223738 X:78957251-78957273 AAGAATATGTCCAGATTGGAGGG + Intronic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1194724848 X:97383720-97383742 ATAAATATGCAGAGATGGGAAGG - Intronic
1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG + Intronic
1195055683 X:101142220-101142242 AAGATAATACAGAAATTGTAAGG - Intronic
1195219526 X:102733157-102733179 AAGAATACTCACAAATTGGCTGG + Intronic
1195550605 X:106165387-106165409 AAGGATAAGGAGCAATTGGAAGG - Intergenic
1195570561 X:106394621-106394643 AAGAAGTGGCAGAAATTGCAGGG + Intergenic
1195645653 X:107228142-107228164 AAGGATATTCAGAGATGGGAGGG + Intronic
1196256396 X:113524244-113524266 AAGAATAAGCAGAATATGGTTGG - Intergenic
1196316969 X:114238306-114238328 GAGAATGTGGAGAAATAGGAAGG - Intergenic
1196382486 X:115106556-115106578 AAGAATAGCAAGAAAATGGACGG + Intergenic
1197550198 X:127883312-127883334 AATAATATCCAGAATTTGTAAGG + Intergenic
1198082691 X:133254101-133254123 AAGGAAAGGCAGCAATTGGATGG + Intergenic
1199225781 X:145371665-145371687 AAGAATTTTCAGAATTTGAATGG - Intergenic
1200781402 Y:7219708-7219730 CAGATTTTGCAGAAATTGCAAGG + Intergenic
1201866736 Y:18663855-18663877 AAGGATGTGTAGAAATAGGAAGG + Intergenic