ID: 982225557

View in Genome Browser
Species Human (GRCh38)
Location 4:153162827-153162849
Sequence GAACCCAAGATGCCACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982225552_982225557 10 Left 982225552 4:153162794-153162816 CCAGTGAGGCAGCACCAACAGAC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 154
982225555_982225557 -4 Left 982225555 4:153162808-153162830 CCAACAGACTATAGGGCTTGAAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982225557 Original CRISPR GAACCCAAGATGCCACCTGA GGG Intronic
901437247 1:9254969-9254991 GAACTCAGGATGCTAACTGATGG - Intronic
901514555 1:9736275-9736297 GAAGCCAAGAGGTCCCCTGAGGG + Intronic
903646771 1:24900855-24900877 GACCCCCAGCTGCCTCCTGAGGG - Exonic
907074549 1:51566448-51566470 GAGCCCCAGCTGCCACCTGCTGG + Intergenic
908752695 1:67439775-67439797 GAGCCCAAGGTGAGACCTGATGG - Intergenic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
911062735 1:93761905-93761927 TCACCCAAGAAGCCACTTGAGGG + Intronic
913028817 1:114875675-114875697 GAACACATGCTGCCAGCTGATGG + Intronic
915691634 1:157696334-157696356 GAACACAAGATGGCATGTGAAGG + Intronic
920423715 1:205855854-205855876 GAACCTAAGATCACACCTCAAGG + Intergenic
921934053 1:220779636-220779658 GAACCCAAGTTACAATCTGAAGG - Intronic
922972429 1:229754101-229754123 CAACCCCAAATGCCACCTGCAGG + Intergenic
923586810 1:235280566-235280588 GAACCCAAGATGGCAGCTTCAGG + Intronic
924633185 1:245761601-245761623 GAACCCATGATGCCAACTCAGGG - Intronic
1066748782 10:38631451-38631473 GACACCAAGTTGCCACCTGGTGG + Intergenic
1066967883 10:42286335-42286357 GACACCAAGTTGCCACCTGGTGG - Intergenic
1067194379 10:44102928-44102950 GGGCCCAATTTGCCACCTGATGG + Intergenic
1067514486 10:46925993-46926015 AAAACCAATATGCCACCTAAAGG - Intronic
1067647774 10:48125820-48125842 AAAACCAATATGCCACCTAAAGG + Intergenic
1068169687 10:53377661-53377683 TAACCCAAGTTGCCACTTGTTGG + Intergenic
1073440573 10:103550225-103550247 GAAACCAAGATGGCACCCAAGGG + Intronic
1073714707 10:106091024-106091046 TAACCCCAGATGGCACCTGTGGG - Intergenic
1075441155 10:122480317-122480339 GAACCCCAGTTGCCACATCAGGG + Intronic
1076907546 10:133370853-133370875 GACCCCAAGAGGCCCTCTGAGGG + Intronic
1077054534 11:584531-584553 GAATCCAAGCTGCCACCTGAGGG + Intronic
1077476924 11:2794886-2794908 GAAAGCAAGATGCCACCAGTGGG + Intronic
1077596296 11:3534584-3534606 CAACCAAAGAAGCCACCTGGAGG + Intergenic
1078060791 11:8041542-8041564 GATCCCAAGATGCCAAGTAATGG - Intronic
1078977590 11:16495744-16495766 ACACCCAAGAAGCTACCTGAAGG + Intronic
1081092539 11:38890487-38890509 GGATCCAAGAGGGCACCTGAAGG - Intergenic
1081863322 11:46346446-46346468 GAACCCAAGCAGTCACCTGTAGG - Intronic
1083638943 11:64135146-64135168 GTGCCCCAGATGGCACCTGAGGG + Intronic
1084201523 11:67561877-67561899 GCACCCCAGATGGAACCTGAAGG + Intergenic
1084252204 11:67908561-67908583 CAACCAAAGAAGCCACCTGGAGG + Intergenic
1084405039 11:68966977-68966999 GAACCCATTATGCCAACTAAGGG + Intergenic
1084490006 11:69473070-69473092 GAAATCAAGACGCCACCTCAGGG + Intergenic
1084820645 11:71687472-71687494 CAACCAAAGAAGCCACCTGGAGG - Intergenic
1090808960 11:130220388-130220410 CATCCCAAGAGGCCACCTGTAGG - Intergenic
1090839196 11:130474213-130474235 GAGCCCATGGGGCCACCTGAGGG - Exonic
1091776166 12:3186174-3186196 GAAGCCAAGATGGCACCTAGGGG + Intronic
1092422471 12:8343355-8343377 CAACCAAAGAAGCCACCTGGAGG + Intergenic
1094268828 12:28588904-28588926 AGTCCCAAGATGCCAACTGATGG + Intergenic
1100887173 12:99084299-99084321 GAACCTGAGCTGCCACCTGGGGG + Intronic
1104409432 12:128545826-128545848 GAATCCAAGAAGCCACCTTAAGG - Intronic
1106761601 13:32873681-32873703 GAACCCAAGCTCCCTCCTGGTGG + Intergenic
1107448560 13:40488932-40488954 GAAGGCAAGTTGCCACGTGAGGG + Intergenic
1108573117 13:51769472-51769494 GCCCCCAAGGTGTCACCTGATGG + Intronic
1109527358 13:63593809-63593831 GAAACCACGAACCCACCTGAAGG + Intergenic
1113405571 13:110036445-110036467 TAACCCCAGATGCTAACTGAGGG - Intergenic
1113995298 14:16059333-16059355 GATCCCAAGATGGAGCCTGATGG + Intergenic
1117727192 14:58686559-58686581 GAAACCAAGAACCCACCAGAAGG - Intergenic
1118910110 14:70054817-70054839 GAACCCAAGATGTAGCCTGTAGG + Intronic
1119203855 14:72779442-72779464 GAACCCAAGATGGCTCCCAATGG + Intronic
1120776150 14:88440037-88440059 GAACCCAAGAAGCAACTAGAGGG - Intronic
1121154376 14:91668934-91668956 GAAACCAAGAACCCACCGGAAGG + Intronic
1122409335 14:101518012-101518034 GACCCTGAGAGGCCACCTGAAGG + Intergenic
1122985713 14:105210719-105210741 GAGCCCAAGATGGCTCCTGGCGG - Intronic
1125091029 15:35793005-35793027 CACCCCAACATGCCACCTGCAGG - Intergenic
1128887707 15:71303700-71303722 GGACCCAAGATGCCAGCATAAGG - Intronic
1133375810 16:5286246-5286268 CAACCAAAGAAGCCACCTGGAGG - Intergenic
1134624733 16:15715338-15715360 GCACTCAAGATGCCACCTCCAGG - Intronic
1135956158 16:26958229-26958251 CACCACAAGAGGCCACCTGAGGG - Intergenic
1137627578 16:49919359-49919381 GAAAGCAAGACGCCACCTGAAGG - Intergenic
1138554310 16:57762976-57762998 GCTCCCAAGATGCCCCCTCAGGG + Intronic
1138643042 16:58401102-58401124 GAGACCAAGAACCCACCTGAAGG - Intronic
1139965583 16:70743665-70743687 GAAACCAAGAACCCACCAGAAGG + Intronic
1143585484 17:7848347-7848369 GAATTCAAGATCCTACCTGATGG + Exonic
1143800587 17:9376839-9376861 GAGACCAAGAACCCACCTGAAGG + Intronic
1144478452 17:15609485-15609507 GAGCCCAAGAAGCCACATGGTGG + Intronic
1144919839 17:18754226-18754248 GAGCCCAAGAAGCCACATGGTGG - Intronic
1145986811 17:29052518-29052540 GGACCCGAGATCCCTCCTGAAGG + Intronic
1148956827 17:51361163-51361185 AAACCCAAGTGGGCACCTGAAGG + Intergenic
1151508350 17:74543604-74543626 GGAGCTAAGATCCCACCTGAGGG - Intronic
1156578211 18:38344371-38344393 AAACCCCAGATTCCACCAGAAGG + Intergenic
1159938259 18:74385832-74385854 GGACCCAAGTGGGCACCTGAGGG + Intergenic
1160899279 19:1419135-1419157 GAACCCAAGTTGCCACGTCAGGG - Intronic
1161558402 19:4957275-4957297 GGACACAAGATCCCAGCTGATGG + Intronic
1163796397 19:19340743-19340765 GGACCTAATATGCCACCTCAGGG - Intronic
1164993266 19:32699742-32699764 GAAACCAAGAACCCACCAGAAGG - Intronic
1166003065 19:39889738-39889760 CAGCCCAAGCTGCCACCGGATGG + Exonic
1166005852 19:39905990-39906012 CAGCCCAAGCTGCCACCGGATGG + Exonic
1166106151 19:40599099-40599121 GAAACCAAGACGCATCCTGAGGG - Intronic
1166140515 19:40802883-40802905 GAACCCAAGATGGGATCTGCAGG - Intronic
1168085947 19:54046816-54046838 GAGCCAAAGATACCATCTGAGGG + Intronic
1168677359 19:58288487-58288509 GAACTCTAGATGTCACCTGCTGG + Intronic
925575420 2:5355355-5355377 GAAACAGAGATGCCAACTGAAGG + Intergenic
926657773 2:15427677-15427699 GAAACAAAGATGCCTCCTGCAGG + Intronic
930723868 2:54664054-54664076 CAACCAAGGATGCCACCAGAAGG - Intronic
932417302 2:71581231-71581253 GAATCCACGATGCCACGTGTGGG - Intronic
933915206 2:86984381-86984403 GGAACCAAGATGCCATCTGATGG - Intronic
934007787 2:87785519-87785541 GGAACCAAGATGCCATCTGATGG + Intronic
935771424 2:106426437-106426459 GGAACCAAGATGCCCTCTGATGG + Intronic
935908650 2:107869511-107869533 GGAACCAAGATGCCATCTGATGG - Intronic
935995053 2:108761726-108761748 GGAACCAAGATGCCATCTGATGG - Intronic
938183456 2:129206378-129206400 GAACACAAGAATTCACCTGAAGG - Intergenic
1168819021 20:761223-761245 GCACCCACGAGGCCACCTGCGGG + Exonic
1169587037 20:7096763-7096785 GACCCCAAGAGCCCACTTGATGG - Intergenic
1169772771 20:9219572-9219594 GAGCCCCAGATGTCACCTGGTGG + Intronic
1170717617 20:18845589-18845611 GAACCCAAGAGGTTAGCTGAGGG + Intergenic
1174568143 20:51481680-51481702 GGACCCAAGAAGCCAACTGCAGG + Intronic
1177559311 21:22729858-22729880 GGACCCAAGTGGGCACCTGAAGG + Intergenic
1180311794 22:11248076-11248098 GATCCCAAGATGGAGCCTGATGG - Intergenic
1182642990 22:31783390-31783412 GAGACCAAGAACCCACCTGAAGG + Intronic
1183343940 22:37296543-37296565 GAAGCCCAGCTGCCACCTGGTGG - Intronic
1183746655 22:39695619-39695641 GAACCGAAGATGCCACCCTCTGG + Intergenic
949741290 3:7237443-7237465 GAGCCCAAGAACCCACCAGAAGG - Intronic
952947202 3:38486318-38486340 GAACCAGATATACCACCTGATGG - Exonic
954400758 3:50318319-50318341 GAACCCCAGCTGCGACCTGTGGG - Exonic
961286879 3:125813092-125813114 CAACCAAAGAAGCCACCTGGGGG - Intergenic
963080006 3:141382739-141382761 GAACCTAGGATGCCACCAGCTGG - Intronic
963696426 3:148571283-148571305 GAGACCAAGAACCCACCTGAAGG + Intergenic
963882553 3:150545661-150545683 CAACCCAAGACTCTACCTGATGG + Intronic
967072041 3:185970960-185970982 GAAGCCAAGAAGCAACCTGGTGG - Intergenic
969010875 4:4061028-4061050 CAACCAAAGAAGCCACCTGGAGG + Intergenic
969521815 4:7682438-7682460 GAACCCCACTTGCCATCTGATGG + Intronic
969802574 4:9580957-9580979 CAACCAAAGAAGCCACCTGGAGG - Intergenic
971037406 4:22709190-22709212 CAAACTAACATGCCACCTGATGG - Intergenic
974124278 4:57676593-57676615 GAAACCAAGAACCCACCGGAAGG + Intergenic
977437503 4:97018060-97018082 GATCCCAAAATGCCTCATGAGGG + Intergenic
979818626 4:125142758-125142780 GAAACTAAGATGACACCTCAAGG + Intergenic
980032319 4:127845218-127845240 AGACCCAAGTTGGCACCTGAAGG + Intergenic
980774632 4:137421987-137422009 GAAACCACGAAGCCACCAGAAGG + Intergenic
981579407 4:146236837-146236859 GCTCCCAAGATGCCATCTGAAGG - Intergenic
982225557 4:153162827-153162849 GAACCCAAGATGCCACCTGAGGG + Intronic
985376001 4:189339155-189339177 AAACCCAGGATGGCACCTTAGGG - Intergenic
988113443 5:26853034-26853056 GAGCCCAAGAACCCACCGGAAGG + Intergenic
988608486 5:32703258-32703280 GACCCCAAGATGCCATTAGATGG - Intronic
989760904 5:45015154-45015176 GAGACCAAGAACCCACCTGAAGG + Intergenic
991199913 5:63980053-63980075 CAAACCAAAATGCCACCTGTAGG - Intergenic
992749506 5:79849401-79849423 AAACCCAAAATGGCACCAGAAGG + Intergenic
995644535 5:114296279-114296301 GGGCCCAAGATGCCACCAGGAGG - Intergenic
996244999 5:121251968-121251990 GAATCCAAGCTGCCTCCTGTGGG + Intergenic
1000535496 5:162473100-162473122 GAGACCAAGATTCCACCAGAAGG + Intergenic
1002892418 6:1347057-1347079 GAAGCCAAGATGCCCCTTAAGGG + Intergenic
1003501893 6:6710070-6710092 GTACCAGAGATGCCACCTTATGG - Intergenic
1005088975 6:22036394-22036416 GAAACAATGAGGCCACCTGAGGG - Intergenic
1006372484 6:33653934-33653956 GGACCCCAGCTGCCTCCTGAGGG + Intronic
1006729880 6:36228908-36228930 GATCCCAAGATGCCCCGGGAGGG + Exonic
1006900964 6:37500776-37500798 GAGACCAAGAACCCACCTGAAGG - Intergenic
1007165221 6:39824297-39824319 GACCCCAAGATGCCCCCTGCTGG - Intronic
1008551658 6:52638615-52638637 GAGACCAAGAACCCACCTGAAGG - Intergenic
1008761873 6:54861594-54861616 GAACCCAAGAGACCACATCATGG - Intronic
1017682687 6:156880036-156880058 GGAGCCCAGATGCCCCCTGATGG + Intronic
1019634790 7:2069788-2069810 GAACCCGAGAGGCCTCCTGTGGG + Intronic
1023550766 7:41367874-41367896 GGGCCCACGAAGCCACCTGAGGG + Intergenic
1024503173 7:50135397-50135419 GATCCCAAGAGGTCCCCTGATGG + Intronic
1026770956 7:73198542-73198564 GAAGACATGATGCCCCCTGAAGG - Intergenic
1027011823 7:74751939-74751961 GAAGACATGATGCCCCCTGAAGG - Intronic
1027076217 7:75194112-75194134 GAAGACATGATGCCCCCTGAAGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1031508901 7:122624428-122624450 GAACCCCAGATGTCATCTAATGG - Intronic
1033395134 7:140966773-140966795 GAAGCCAAGTTCACACCTGATGG - Intergenic
1035071171 7:156146126-156146148 GAAACCAAGATGGCCCCTGAAGG + Intergenic
1036248400 8:7140649-7140671 CAACCAAAGAAGCCACCTGGAGG - Intergenic
1036252408 8:7173688-7173710 CAACCAAAGAAGCCACCTGGAGG + Intergenic
1036365086 8:8113772-8113794 CAACCAAAGAAGCCACCTGGAGG - Intergenic
1040319808 8:46286810-46286832 GAACCCTAGCCCCCACCTGAAGG + Intergenic
1041728327 8:61039434-61039456 GAAACCACCATGCTACCTGAAGG - Intergenic
1041965423 8:63669866-63669888 GAACACAAGAACCCACCTAATGG - Intergenic
1044193166 8:89343257-89343279 GAACTCAAGTTCCCACCAGAAGG + Intergenic
1044697385 8:94936793-94936815 GAACCCAGGATGGCACCTCCAGG - Intronic
1049943997 9:576881-576903 GAGACCAAGAAACCACCTGAAGG - Intronic
1053415422 9:37944277-37944299 CAGCCCAAGCTGCCACCTGTCGG - Intronic
1187945941 X:24426653-24426675 GATCCCCAGATTACACCTGAGGG + Intergenic
1188014894 X:25097666-25097688 GAACCCAAGATCCAACCTGAAGG + Intergenic
1188076878 X:25787849-25787871 GAATTCAAGATGCCTCTTGAGGG + Intergenic
1188722714 X:33543312-33543334 CAGGACAAGATGCCACCTGATGG - Intergenic
1195322220 X:103729143-103729165 GACCCCAAGAGACGACCTGAGGG - Intergenic
1200341162 X:155397478-155397500 GAACCAAAAATGACACCTAACGG + Intergenic