ID: 982225860

View in Genome Browser
Species Human (GRCh38)
Location 4:153165771-153165793
Sequence AAGGAAAAGGAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3047
Summary {0: 1, 1: 1, 2: 27, 3: 328, 4: 2690}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982225860_982225865 22 Left 982225860 4:153165771-153165793 CCATCCTCACTCTCCTTTTCCTT 0: 1
1: 1
2: 27
3: 328
4: 2690
Right 982225865 4:153165816-153165838 CTGTGTATTCTCATATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982225860 Original CRISPR AAGGAAAAGGAGAGTGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr