ID: 982230576

View in Genome Browser
Species Human (GRCh38)
Location 4:153205095-153205117
Sequence GTACCCTTTGAGCACTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982230576_982230577 3 Left 982230576 4:153205095-153205117 CCATAAAAGTGCTCAAAGGGTAC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 982230577 4:153205121-153205143 GTCCCTCTGCCGTGCGACTGTGG 0: 1
1: 0
2: 0
3: 4
4: 83
982230576_982230581 23 Left 982230576 4:153205095-153205117 CCATAAAAGTGCTCAAAGGGTAC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 982230581 4:153205141-153205163 TGGAATGAAGAAATAGCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982230576 Original CRISPR GTACCCTTTGAGCACTTTTA TGG (reversed) Intronic