ID: 982235667

View in Genome Browser
Species Human (GRCh38)
Location 4:153249256-153249278
Sequence CAGGCGGAAGAAAAGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 741}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235667_982235682 21 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235682 4:153249300-153249322 CGGGGCGGGGCCTGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 150
982235667_982235676 6 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235676 4:153249285-153249307 GCTCGGCTCCCGCCTCGGGGCGG 0: 1
1: 0
2: 2
3: 20
4: 147
982235667_982235674 2 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235674 4:153249281-153249303 CGCAGCTCGGCTCCCGCCTCGGG No data
982235667_982235673 1 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235673 4:153249280-153249302 GCGCAGCTCGGCTCCCGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 282
982235667_982235683 28 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235667_982235684 29 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235667_982235677 7 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235677 4:153249286-153249308 CTCGGCTCCCGCCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 28
4: 172
982235667_982235675 3 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235675 4:153249282-153249304 GCAGCTCGGCTCCCGCCTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 123
982235667_982235678 8 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235678 4:153249287-153249309 TCGGCTCCCGCCTCGGGGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235667 Original CRISPR CAGGCGGAAGAAAAGAAGGC GGG (reversed) Intronic
900163226 1:1234396-1234418 CAGGAGGAAGAAACGGGGGCGGG + Exonic
900434996 1:2625871-2625893 CAGGCTGGAGGAGAGAAGGCAGG - Intronic
900932912 1:5747880-5747902 CAGGAGGGAGAAAGGAAGGGAGG + Intergenic
901514779 1:9737758-9737780 AAGGTGGAACAAAAGAAGCCTGG - Intronic
902108798 1:14060591-14060613 GAGGCAGAAGAAAAGAAGTCAGG - Intergenic
902243157 1:15101978-15102000 AAGGAGGAAGAGAAGATGGCTGG - Intronic
902253044 1:15168361-15168383 AATGGGGAAGAAAAGAAGGAAGG + Intronic
902799194 1:18818999-18819021 CAGGCATAAGAAAATAAGCCGGG + Intergenic
903377422 1:22875654-22875676 CTGGAGGAAGAAACGAAGACAGG - Intronic
903703967 1:25271530-25271552 AAAGAGGAAGAAAAGAAGGAAGG - Intronic
903723272 1:25421786-25421808 AAAGAGGAAGAAAAGAAGGAAGG + Intronic
903748102 1:25602218-25602240 TGGGCGGAGGAAAAGGAGGCAGG + Intergenic
904130039 1:28268725-28268747 GAGGAGGAAGAAAGGAAGGAAGG + Intronic
904455472 1:30645425-30645447 GAGGGAGAAGAAAAGAAGGGAGG - Intergenic
904456206 1:30649725-30649747 CAGGGAGGAGAAAAGCAGGCAGG - Intergenic
905506867 1:38486658-38486680 CAGGAGGAAGGGAAGAAGGAAGG + Intergenic
906155291 1:43610486-43610508 CAGCCGGAAGACTTGAAGGCTGG + Intronic
906301344 1:44684093-44684115 AAGGCAGAAGGAATGAAGGCAGG - Intronic
906439377 1:45827579-45827601 CAGAATGAAGGAAAGAAGGCAGG + Intronic
906729617 1:48070012-48070034 CAGGAGGAAGGAAAGATGACAGG + Intergenic
906745996 1:48222584-48222606 CAGTTGGGAGAAAAGGAGGCAGG + Intergenic
906936026 1:50214740-50214762 CATGCTGCAGAAAAGAAGGCGGG + Intergenic
907294649 1:53442577-53442599 CAGGAGGAAGAAAAGAGAGTGGG - Intergenic
907796568 1:57724229-57724251 CAGGAGGAAGAAAGAAAGGAAGG + Intronic
907885258 1:58586944-58586966 GAGACGGATGAATAGAAGGCTGG - Intergenic
907918117 1:58889148-58889170 AAGGCTGAAGAAAGGAAGACCGG - Intergenic
908582755 1:65533873-65533895 CATACGGAACAAAAGAAAGCTGG - Intronic
908719010 1:67103086-67103108 TAAGAGTAAGAAAAGAAGGCTGG + Intronic
909588454 1:77318249-77318271 CAGGAGGAAGAAAGAGAGGCGGG + Intronic
910243020 1:85108762-85108784 AAGGGGGAAGGAAAGAAGGGAGG - Intronic
910370670 1:86512424-86512446 CAGGCTGAAGAAGAGAAGGCAGG - Intergenic
910588246 1:88902017-88902039 CAGGCTGGAGAAGAGAAGGCAGG - Intergenic
910790359 1:91044015-91044037 CAGGCTGGAGAAGAGAAGGTGGG - Intergenic
911485965 1:98505395-98505417 CAGGCAGAAGCAAAGCAGGGAGG + Intergenic
911967435 1:104385881-104385903 CAGGAGGAAGAAAAGAAATTGGG - Intergenic
912714619 1:111974166-111974188 CTGGCCGGAGAAAAGCAGGCTGG + Intronic
913477842 1:119256271-119256293 AAGGTGGAAGGAAAGAAGGAAGG - Intergenic
913502033 1:119480319-119480341 AAGGAGGAAGAAAGGAAGGGAGG + Intergenic
913583912 1:120254679-120254701 CAGAACGAAGGAAAGAAGGCAGG + Intergenic
913624260 1:120643641-120643663 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
913966718 1:143382984-143383006 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914061095 1:144208591-144208613 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914081423 1:144414274-144414296 CAGGTGGAAAAAAAAAAGTCTGG - Intergenic
914118055 1:144757778-144757800 AAGGGAGAAGAAAGGAAGGCAGG + Intergenic
914362214 1:146944939-146944961 AGGGAGGAAGAAAAGAAGGGAGG - Intronic
914362259 1:146945059-146945081 AGGGAGGAAGAAAAGAAGGGAGG - Intronic
914565901 1:148866515-148866537 CAGAACGAAGGAAAGAAGGCAGG + Intronic
914606924 1:149263733-149263755 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
915414166 1:155727573-155727595 GAGGCAGAAGAAAACAAGCCAGG - Intronic
915456280 1:156042921-156042943 AAGGCGGAAAAAAAGAAAACAGG + Intronic
916106295 1:161435035-161435057 CAGGCTGGGGGAAAGAAGGCAGG + Intergenic
916119280 1:161513324-161513346 AAGGGGGAAGGAAGGAAGGCAGG - Intronic
916129042 1:161594983-161595005 AAGGGGGAAGGAAGGAAGGCAGG - Intronic
916386064 1:164271856-164271878 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
916410835 1:164545476-164545498 AAGATGGAGGAAAAGAAGGCTGG + Intergenic
917147545 1:171908925-171908947 CAGGAGGAAGGAAAGATGGAAGG - Intronic
917211518 1:172636592-172636614 CAGGAGGAAGATAAGAGGGAGGG - Intergenic
917471386 1:175328794-175328816 CAGGCGGATGAAGAGGAGGGAGG + Intronic
917782484 1:178413025-178413047 CAGACGGAAGGAAGGAAGGAAGG - Intronic
917797643 1:178543142-178543164 CCGGCGGGAGAAGAGGAGGCTGG - Intronic
917947945 1:179995742-179995764 CAGGAGTAAGCACAGAAGGCTGG - Intronic
918510742 1:185311188-185311210 CAGGTGGTTGAAATGAAGGCAGG + Exonic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919348029 1:196411145-196411167 CAGAAGGAAAAAAAGAAGGAAGG - Intronic
919613553 1:199776925-199776947 AGGGAGGAAGGAAAGAAGGCAGG - Intergenic
919939987 1:202279436-202279458 CAAGGGGAAGAAAATCAGGCTGG - Intronic
921214543 1:212925880-212925902 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
922213488 1:223502640-223502662 TAGGCGGACGAAAAGGAGGAAGG + Intergenic
922303433 1:224323673-224323695 CAGGAGGCTCAAAAGAAGGCAGG + Intronic
922438424 1:225629277-225629299 CGGAAGAAAGAAAAGAAGGCAGG + Intronic
922781012 1:228252286-228252308 CAGGCTGGAGGAGAGAAGGCAGG + Intronic
923688789 1:236173436-236173458 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
924288167 1:242509513-242509535 AAGGAGGAAGAAAGAAAGGCAGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062890729 10:1057360-1057382 CAGGCCGAAGCAAAGGGGGCGGG - Intronic
1062965574 10:1605179-1605201 CAGCCAGAAGAAGAGAAGGAAGG - Intronic
1063027253 10:2192575-2192597 AAGGAGGAAGAAAAAAAGCCAGG - Intergenic
1063140034 10:3247849-3247871 GAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1063144342 10:3283334-3283356 AAGGAGGAAGGAAAGAAGGAAGG - Intergenic
1063999695 10:11653383-11653405 AAGGAAGAAGAAAAGAGGGCGGG - Intergenic
1064134214 10:12736682-12736704 CAGGAGGAAGAAAAAAAGTTTGG - Intronic
1064194529 10:13234348-13234370 CAGGCGAGAGGAAGGAAGGCGGG + Intergenic
1064936296 10:20682638-20682660 GAGGAGGGAGAAAAGAAGGAAGG - Intergenic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065475648 10:26135465-26135487 AAGGCAGGATAAAAGAAGGCAGG + Intronic
1065834590 10:29645265-29645287 GAGGGGGAAAAAAAGAAGGAAGG + Intronic
1066638605 10:37533014-37533036 CAGATGGACGAAATGAAGGCAGG - Intergenic
1066779814 10:38931927-38931949 AAGAAGGAAGAAAAGAAGGGAGG + Intergenic
1067228618 10:44391534-44391556 CAGGCAGAAGACCACAAGGCGGG - Intergenic
1068174008 10:53433506-53433528 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1068557659 10:58477230-58477252 CTGGAGGAAGGCAAGAAGGCAGG - Intergenic
1068860384 10:61841706-61841728 CTGGCAGTAGAAAAGCAGGCTGG + Intergenic
1070408407 10:76116810-76116832 AAGGTGGAAGAAGAGAAGCCAGG - Intronic
1070511652 10:77166666-77166688 GAGGAAGAAGAAAAGAAGGAGGG + Intronic
1070852688 10:79580681-79580703 AAGGAGGATGAAAAGAAGGAAGG + Intergenic
1070905349 10:80067178-80067200 CATGCAGAATAAAAAAAGGCAGG + Intergenic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071460317 10:85887673-85887695 CATCAGGAAGAGAAGAAGGCGGG - Intronic
1071814849 10:89222198-89222220 CAGGAGGAGGAAAAGAAAGCTGG + Intronic
1071965037 10:90843706-90843728 AAGGTGGAAGAAAAGAAAGGGGG + Intronic
1072360500 10:94654443-94654465 CAGGCTGGAGGAAAGAAGGCAGG - Intergenic
1072738479 10:97895510-97895532 AAGGAGGAAGAGAAGAAAGCAGG + Intronic
1072779670 10:98239427-98239449 CAAGCGGGAGAAAGAAAGGCTGG - Intronic
1073291920 10:102417324-102417346 CAGGCAGAAGGAAAGGAGCCAGG - Intronic
1073454793 10:103629952-103629974 CAGGCAGAGGGAACGAAGGCAGG - Intronic
1073656654 10:105424198-105424220 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1073853457 10:107647884-107647906 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1073882517 10:107999818-107999840 CAGCCTTAAAAAAAGAAGGCAGG + Intergenic
1073918445 10:108432020-108432042 CAGGCTGGAGAAGAGAAGGCAGG + Intergenic
1073995839 10:109314423-109314445 CAGGCTGGAGAAGAGAAGGCAGG + Intergenic
1074002732 10:109388685-109388707 AAGAAGGAAGAAAAGTAGGCAGG + Intergenic
1074359223 10:112811857-112811879 CAGCCGGAATCACAGAAGGCTGG - Intronic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074984439 10:118644385-118644407 CAGAGTGAAGAAAAGAAGTCAGG - Intergenic
1075085610 10:119412524-119412546 CAGACCAAAGGAAAGAAGGCAGG - Intronic
1075560304 10:123463386-123463408 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
1075656249 10:124163032-124163054 CAGGCAGGAGGAAGGAAGGCAGG + Intergenic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1076013089 10:127006258-127006280 CAGGCAGGAGAGCAGAAGGCAGG - Intronic
1076252356 10:128994617-128994639 CAGGAGGAAGGAAAGAAGGAGGG + Intergenic
1078002042 11:7504814-7504836 CAGGATGAAGGAAAGAAGACTGG - Intronic
1078467991 11:11564476-11564498 CGTGGGGAAGAAAAGAAGGGAGG - Intronic
1078987346 11:16608409-16608431 CAGGGAGAAGACAAGAAGGGTGG + Intronic
1079102689 11:17551677-17551699 GAGAGGGAAGAAAAGGAGGCTGG + Intronic
1079189361 11:18265036-18265058 AGGGAGGAAGAAAAGAAGGAAGG + Intergenic
1079410485 11:20182853-20182875 CAGACAGAAGAGGAGAAGGCTGG - Intergenic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1080054349 11:27890219-27890241 GAGGAAGAAGAAAAGAAGGATGG - Intergenic
1080281190 11:30558721-30558743 AAGAAGGAAGAAAAGAAGGAAGG - Intronic
1080407994 11:31997014-31997036 CAGCCAGAATAAAAGCAGGCAGG - Intronic
1080445445 11:32333656-32333678 CAGGCGGAAGGGAAGCAGCCAGG + Intergenic
1080857296 11:36123385-36123407 CAGGAGAAAGAAAAGCAGGTAGG - Intronic
1080888781 11:36390328-36390350 CTGGTGGAAGACATGAAGGCAGG + Intronic
1081065427 11:38534608-38534630 CAGGCTGGAGAAGACAAGGCAGG + Intergenic
1081283781 11:41244222-41244244 AAGAAGGAAGAAAAGAGGGCAGG + Intronic
1081567071 11:44266564-44266586 CAGGGAGAAGTAAAGGAGGCAGG + Intronic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1082196786 11:49316216-49316238 CAGGAGGAAGGAAGGAAGGAAGG + Intergenic
1082611608 11:55305637-55305659 AAGCCGGAAGAAAAGTAGGAGGG + Intergenic
1082892734 11:58157527-58157549 AAGAAGGAAGAAAAGAAGGAAGG + Intronic
1083266088 11:61547445-61547467 CGGGAGGAAGAAAGGCAGGCGGG + Intronic
1083542170 11:63519598-63519620 CTGGAGGGAGAAAAGAAGGAAGG + Intergenic
1083873732 11:65508659-65508681 GAGGAGGCAGAAAAGTAGGCCGG + Intergenic
1084406544 11:68977153-68977175 AAGGGGGAAGAAAAGAAGGAAGG + Intergenic
1084489246 11:69469407-69469429 CAGGGGGAAGACATGAAGGAAGG + Intergenic
1085703191 11:78763379-78763401 AAGGGGGAAAAAAAGAAGGGGGG + Intronic
1085778093 11:79383997-79384019 CATGGGGAAGAAAGGAAGGGGGG - Intronic
1086386677 11:86316212-86316234 GAGGAAAAAGAAAAGAAGGCCGG + Intronic
1086698259 11:89869029-89869051 AAGCCGGAAGAAAAGTAGGAGGG - Intergenic
1086707905 11:89975459-89975481 AAGCCGGAAGAAAAGTAGGAGGG + Intergenic
1086715399 11:90055693-90055715 AAGCCGGAAGAAAAGTAGGAGGG - Intergenic
1087645104 11:100799842-100799864 AAGGTGGAAGAAAAGAAAGAGGG + Intronic
1088112026 11:106273246-106273268 AAGGCAGTAAAAAAGAAGGCAGG - Intergenic
1088265447 11:107983867-107983889 CAGGCTGGAGAAGAGAAGGCAGG - Intergenic
1088449385 11:109965637-109965659 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1089915963 11:122156578-122156600 CAGGAGGAAGGAAGGAAGGAAGG + Intergenic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1091005270 11:131947523-131947545 AAGAAGGAAGAAAGGAAGGCAGG + Intronic
1092022210 12:5212002-5212024 AAGGGGGAAGGAAAGAAGGAAGG + Intergenic
1092022231 12:5212156-5212178 AAGGGGGAAGGAAAGAAGGAAGG + Intergenic
1092192941 12:6533674-6533696 CAGGCGGAGGACAGGATGGCTGG - Intergenic
1093698313 12:22188739-22188761 CAGGGGGAAGAAGAGAGGGCAGG + Intronic
1093772572 12:23034633-23034655 GAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1095315117 12:40751015-40751037 CAGGAGGAAGAAAACAAAGATGG + Intronic
1095603889 12:44044594-44044616 CAGGCTGAGGGAGAGAAGGCAGG - Intronic
1095680754 12:44972848-44972870 AAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1095695008 12:45133841-45133863 CAAGCGGAAGAAAAGATATCAGG + Intergenic
1095857238 12:46873849-46873871 AAGACGGAAGAAAGGAAGGAAGG - Intergenic
1096288745 12:50323226-50323248 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1096332350 12:50724974-50724996 CAGGCAGAAGACATAAAGGCAGG - Intronic
1096471480 12:51879889-51879911 AAGACTTAAGAAAAGAAGGCCGG + Intergenic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096778731 12:53979798-53979820 CAGGCGGCAGGCAGGAAGGCAGG - Intergenic
1097587454 12:61531532-61531554 GAGGGGGAAGGAAAGGAGGCGGG + Intergenic
1097978376 12:65711752-65711774 AAGGCATAAGAAAAGAAGGGAGG + Intergenic
1098079433 12:66768539-66768561 CAGGCTGAAGGAGTGAAGGCAGG + Intronic
1098749877 12:74279859-74279881 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1098959324 12:76722434-76722456 AAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1099243830 12:80170728-80170750 CAGTAATAAGAAAAGAAGGCTGG - Intergenic
1099526394 12:83723378-83723400 CAGGCTGGAGGAGAGAAGGCAGG - Intergenic
1099939722 12:89171276-89171298 CAGACTGAAGAAAACAAAGCTGG - Intergenic
1100301925 12:93315386-93315408 CAGGCGGAAGGAAAGAATGCGGG + Intergenic
1101146035 12:101841230-101841252 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1101494074 12:105236871-105236893 CCAGAGGAAGAAAAGAAGGAAGG + Intronic
1101548656 12:105740963-105740985 CAGGCGGAAGAAAGGATGGAAGG + Intergenic
1103396560 12:120611717-120611739 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1103783551 12:123415507-123415529 CAGAAGGGAGAAAAGAAAGCAGG - Exonic
1104238611 12:126964118-126964140 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1104301747 12:127570698-127570720 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1105265262 13:18809392-18809414 CAGGAGGAAGAGAAGAGAGCAGG + Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105740147 13:23315450-23315472 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
1105966342 13:25388193-25388215 AAGGAGGAAGGAAAGAAGGAAGG + Intronic
1105981833 13:25524930-25524952 AAGACGGAAGGAAAGAAGGAAGG - Intronic
1106541731 13:30696639-30696661 CAAGGAGAAGAAAAGATGGCTGG + Intergenic
1106594331 13:31123736-31123758 AAGGAGGAAGAAAAGAAGGGAGG - Intergenic
1106854553 13:33835381-33835403 AATGCTGAAGAAAAGAAGGGAGG + Intronic
1107572167 13:41674262-41674284 AAGGGGGAAGAAAGGAAGCCTGG + Intronic
1107780943 13:43901644-43901666 CAGTCTGAAAAAAAGGAGGCTGG - Intergenic
1108019898 13:46116827-46116849 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1108044601 13:46371852-46371874 CATGGGGAAGACAACAAGGCAGG + Intronic
1108579514 13:51816903-51816925 AAGGGGGAAGAAAATCAGGCAGG + Intergenic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108735890 13:53282928-53282950 CAGGCAGAAGTCAGGAAGGCAGG - Intergenic
1109024758 13:57143017-57143039 CAGGTGGAAGGAAGGGAGGCTGG - Exonic
1109025745 13:57149587-57149609 CAGGTGGAAGGAAGGGAGGCTGG - Exonic
1109026735 13:57156160-57156182 CAGGTGGAAGGAAGGGAGGCTGG - Exonic
1109027727 13:57162731-57162753 CAGGTGGAAGGAAGGGAGGCTGG - Exonic
1109028713 13:57169296-57169318 CAGGTGGAAGGAAGGGAGGCTGG - Exonic
1109029347 13:57173661-57173683 CAGGTGGAAGGAAGGGAGGCTGG - Intergenic
1110057408 13:70990919-70990941 CAGTGAGAAGAAAAGAAGGCTGG + Intergenic
1110066247 13:71110065-71110087 GAGGCAGAAGAAAAGGGGGCAGG - Intergenic
1111057771 13:82972756-82972778 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1111317533 13:86582071-86582093 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
1111965456 13:94857363-94857385 CAGGAGGAAGAATAGGAAGCTGG + Intergenic
1112231098 13:97589894-97589916 CAGGTGGGGGAAGAGAAGGCAGG + Intergenic
1112330642 13:98474749-98474771 CAGGCTAAAGAACAAAAGGCGGG + Intronic
1112971516 13:105268561-105268583 GAAACGGAAGAAAAGAAGGAAGG - Intergenic
1113050909 13:106211005-106211027 AAGGAGGAAGGAAAGAAGGGGGG + Intergenic
1113813790 13:113158248-113158270 CAGGAGGATGGAAAGAAGGAAGG - Intergenic
1113962351 13:114132836-114132858 CTGGCGGAAGAGACGAAGGAAGG + Intergenic
1113992246 14:16036899-16036921 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1114548536 14:23520334-23520356 AAGGGGGAAGAAAAGGAGACTGG + Intergenic
1114724332 14:24918956-24918978 AAGGCAGAAGAAACGAAAGCAGG + Intronic
1115094865 14:29622380-29622402 CAGAAGGAAGGAAAGAAGGAAGG - Intronic
1115130727 14:30049530-30049552 CAGGCTGGGGGAAAGAAGGCAGG - Intronic
1115309606 14:31966047-31966069 CAGTCAGAAGAAAAAAAGTCTGG - Intergenic
1115440579 14:33430251-33430273 AAGGCGGAGGAAAAGAAGAATGG - Intronic
1115492249 14:33968695-33968717 CAGAAGGAAGGAAAGAAGGAAGG + Intronic
1115983619 14:39080921-39080943 CAAGGGCAAGAAAATAAGGCTGG + Intronic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1117247448 14:53900192-53900214 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1117503486 14:56377219-56377241 GAGGGGGAAAGAAAGAAGGCAGG - Intergenic
1117552235 14:56847874-56847896 CTGGGGGATGGAAAGAAGGCAGG + Intergenic
1118122411 14:62859900-62859922 CAGGCTGGGGAAGAGAAGGCAGG + Intronic
1118171584 14:63394561-63394583 AAGGCGGAAGCAAGCAAGGCGGG - Intronic
1118356691 14:65020037-65020059 CATGCAGGGGAAAAGAAGGCAGG - Intronic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1118664347 14:68050696-68050718 GAGGGGGAAGAGAAGAGGGCAGG - Intronic
1118920549 14:70145918-70145940 CAGATGGAAGGAAAGAAGGAAGG + Intronic
1119158442 14:72432657-72432679 CAGGCGGTAGAACAGAAGAAGGG + Intronic
1119190989 14:72681589-72681611 AAGATGGAGGAAAAGAAGGCAGG - Intronic
1119387788 14:74268658-74268680 AAGAAAGAAGAAAAGAAGGCAGG + Intergenic
1119479484 14:74950697-74950719 CAGGTGGGAAAAAAGAAGGTTGG + Intronic
1119566658 14:75634907-75634929 CAGGGGGAAGAAGTGAATGCTGG + Exonic
1121056633 14:90860808-90860830 CAGATGGAAGTAAAAAAGGCAGG + Exonic
1121314539 14:92953209-92953231 CGGGCGGAAGCCAAGCAGGCAGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121553831 14:94821482-94821504 AAGTCAAAAGAAAAGAAGGCTGG - Intergenic
1121800308 14:96769065-96769087 GAGGAGGAAGGAAAGAAGGAAGG - Intergenic
1122486406 14:102084847-102084869 GAGGAAGAAGAAAAGAAGGATGG - Exonic
1122924392 14:104892950-104892972 CAGCCGGCAGGAAAGACGGCAGG - Intronic
1122948588 14:105027133-105027155 AAGGAGGAAGAAAGGAAGGGAGG + Intergenic
1122968278 14:105142005-105142027 CAGGAGGAAGCACAGACGGCAGG + Exonic
1202872194 14_GL000225v1_random:175334-175356 GAGGAGGAAGAAAAAACGGCTGG - Intergenic
1202937446 14_KI270725v1_random:104309-104331 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1124035645 15:26051590-26051612 CAGGAGGAAGGAAGGAAGGAGGG - Intergenic
1124635385 15:31361572-31361594 CAGGGGGAGGAAATGAAGGCTGG + Intronic
1125541532 15:40472388-40472410 CAGGCAGAAGCACAGAAAGCTGG - Exonic
1125547278 15:40515290-40515312 AAGGAGGAAGAAAAGGAGGGTGG - Intergenic
1126283642 15:46986547-46986569 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1127061429 15:55189938-55189960 CCATGGGAAGAAAAGAAGGCCGG + Intronic
1127153029 15:56097995-56098017 GTGGCAGATGAAAAGAAGGCAGG - Intronic
1128050103 15:64656681-64656703 AGGGAGGAAGAAAAGAAGGAAGG - Intronic
1128072556 15:64806826-64806848 GAGGCAGAAGAGAGGAAGGCAGG + Intergenic
1128123636 15:65173748-65173770 CATGCTAAAGAAAATAAGGCTGG + Intronic
1128521529 15:68378130-68378152 CGGTGGGAAGAAAAGATGGCAGG + Intronic
1129279780 15:74475287-74475309 CAGGCTGAAGGAAAAAAGGAAGG + Intergenic
1129290971 15:74567314-74567336 CAGGAGGTAGAAGAAAAGGCTGG - Intronic
1129681057 15:77658582-77658604 AAAGAGGAAGAAAAGAAAGCAGG + Intronic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1130326010 15:82880788-82880810 CTGGTGGAAGAAAAGAAGAGAGG + Intronic
1130969351 15:88720051-88720073 CAGAAGGAAAAAAAGAAGGAAGG - Intergenic
1131066375 15:89437192-89437214 CAGGAGGAAGGAAAGAAAGAAGG - Intergenic
1132912349 16:2320843-2320865 GAGGGGGAAGAAAAGTTGGCTGG - Intronic
1133773466 16:8881135-8881157 CAGGCAAAAAAAAAGAATGCTGG + Intergenic
1133787218 16:8982900-8982922 CAGCAGGAAGAAAGGAAGGAAGG + Intergenic
1134127946 16:11629388-11629410 CAGGAGGAAGAACAGCAGACAGG + Intronic
1134328653 16:13230117-13230139 GAGGAGACAGAAAAGAAGGCAGG + Intronic
1135712076 16:24726267-24726289 AAGGGGGAAGAACAGAAGTCTGG + Intergenic
1136911628 16:34148808-34148830 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1137218683 16:46426550-46426572 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1137279603 16:46964378-46964400 CAGGGGGAAGAAACCAAGCCAGG + Intronic
1138277438 16:55746040-55746062 CAGGCAGAAGGAGAGAGGGCAGG + Intergenic
1138312246 16:56037131-56037153 TAGGGAAAAGAAAAGAAGGCAGG - Intergenic
1138600515 16:58051422-58051444 AAGGAGGAAGAAAGGAAGGGAGG + Intergenic
1138600524 16:58051462-58051484 AAGGAGGAAGAAAGGAAGGGAGG + Intergenic
1138621159 16:58212503-58212525 AAGAAGGAAGAAAGGAAGGCAGG + Intergenic
1138813795 16:60180930-60180952 CAGACGGAAGGAAGGAAGGAAGG - Intergenic
1140317443 16:73912917-73912939 TAGGAGGCAGAAAAGCAGGCAGG - Intergenic
1140801306 16:78490993-78491015 GAGGTGGAAGGAAAGAAGGCTGG - Intronic
1141169923 16:81684810-81684832 TAGGAAGGAGAAAAGAAGGCTGG - Intronic
1141559512 16:84857768-84857790 CAGGCTGGGGGAAAGAAGGCAGG + Intronic
1141638946 16:85329981-85330003 CAGGGGGCAGAAAATAAAGCAGG - Intergenic
1141734665 16:85844240-85844262 AAGGAGGAAGGAAAGAAGGGAGG - Intergenic
1141859849 16:86709072-86709094 AAGGAGGAAGGAAAGAAGGAAGG - Intergenic
1142172779 16:88631575-88631597 GAGGAGGAGGAAGAGAAGGCGGG - Exonic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143970071 17:10789125-10789147 AAGGAGGATTAAAAGAAGGCTGG - Intergenic
1144011280 17:11150524-11150546 CAGCGGGAAGAAAAGAGGTCGGG + Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144415128 17:15039180-15039202 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1144486849 17:15673605-15673627 CAGGAAGAAAAAAAAAAGGCAGG + Intronic
1144686216 17:17227986-17228008 CAGGCGGAAGAAGAGGAAGGTGG - Exonic
1144914174 17:18708690-18708712 CAGGAAGAAAAAAAAAAGGCAGG - Intronic
1145709124 17:26952622-26952644 AAGAAGGAAGAAAAGAAGGGAGG + Intergenic
1146458556 17:33025734-33025756 GAGGAGGAAGAAGAGAAGGTTGG - Intronic
1146930197 17:36771618-36771640 CAGGTGGATGAAAATGAGGCTGG + Intergenic
1147415171 17:40283685-40283707 GAGGCTAAAGAAAAGAAGGGTGG + Exonic
1147590468 17:41680000-41680022 CAGGAGGAAGGAAGGAAGGAAGG + Intergenic
1148138554 17:45311734-45311756 CAGGTGGCTGAAAAGGAGGCAGG + Intronic
1148321688 17:46759734-46759756 AAGGTGGAAGGAAAGAAGGTAGG - Intergenic
1148984138 17:51606840-51606862 CAGGAAGAAGAAAAAAAGCCTGG + Intergenic
1150134974 17:62690550-62690572 CAGGCTGCAGAGAAGAGGGCTGG + Intronic
1151240979 17:72757666-72757688 CCAGGGGAAGAAAAGTAGGCAGG - Intronic
1151819130 17:76487907-76487929 CAGCTGGAAGAAAGGAGGGCCGG + Exonic
1153131244 18:1857435-1857457 CAGGCTGGAGGAGAGAAGGCAGG + Intergenic
1153574240 18:6504719-6504741 CAGAAGGAAGGAAAGAAGGAAGG + Intergenic
1154284014 18:13034840-13034862 CATGGGGAAGAAGAGGAGGCAGG - Intronic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154515835 18:15164567-15164589 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1154519129 18:15208139-15208161 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1155021656 18:21902247-21902269 CCGGCAGAGGAAAGGAAGGCTGG - Intergenic
1155231665 18:23780315-23780337 CAGGGTGAAGGAAAGAAGGAAGG + Intronic
1155470040 18:26182077-26182099 GAAGCGGAAGAAGAAAAGGCTGG + Intronic
1156317492 18:35983968-35983990 GAGGCTGAAGATGAGAAGGCAGG - Intergenic
1156413407 18:36859503-36859525 GGGAGGGAAGAAAAGAAGGCAGG - Intronic
1156700518 18:39819145-39819167 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1157341233 18:46780292-46780314 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1157690090 18:49674475-49674497 CAGGCAGAAGGAAAGAAGGGAGG + Intergenic
1158039476 18:53075579-53075601 AAAGCGGAAGAGAAGAATGCTGG + Intronic
1158418106 18:57267813-57267835 AAGGCAGAAGGAAAGATGGCAGG + Intergenic
1158600669 18:58853306-58853328 CAGACGGAAGGAAGGAAGGAAGG + Intergenic
1158805503 18:60966967-60966989 AAGGAGGAAGGAAGGAAGGCAGG + Intergenic
1159470722 18:68852094-68852116 CCGGGAGAAGAAAAGAAGGCAGG - Intronic
1159657178 18:71045416-71045438 TAGGAGAAAGAAAAGAAAGCAGG - Intergenic
1159868925 18:73738834-73738856 AAGACAGAAGAAAAGAGGGCAGG + Intergenic
1160435541 18:78849494-78849516 AAGGAGGAAGACAGGAAGGCAGG + Intergenic
1160506651 18:79430952-79430974 CAGGCAGAAGGAAAGGCGGCTGG - Intronic
1160580857 18:79884047-79884069 CTGGGAGAAGAAAAGATGGCAGG - Intronic
1160746658 19:714652-714674 CAGTCTAAAAAAAAGAAGGCTGG - Intronic
1162102740 19:8349779-8349801 AAGGAGGAAGGAAAGAAGGAAGG + Intronic
1162517462 19:11157474-11157496 AAGAAGGAAGAAAAGAAGGCCGG - Intergenic
1162553141 19:11369543-11369565 GAGACAGAAGAAAAGGAGGCTGG + Intergenic
1162739377 19:12765445-12765467 CAGGTAAAAGAAAAGAAAGCAGG + Intronic
1163342065 19:16715137-16715159 AAGGAGGAAGAACAGAAGGAGGG - Intergenic
1163518597 19:17779262-17779284 AAGGAGGAAGAAGAGAAGGCAGG + Intronic
1163626068 19:18390477-18390499 CTGGAGGAAGAAAAGGAGTCGGG + Intergenic
1163861254 19:19744106-19744128 CAGGAGGAAGGAAGGAAGGAAGG - Intergenic
1164552288 19:29221759-29221781 CAGGTGGAATAGAAGAAGCCCGG - Intergenic
1164680478 19:30130979-30131001 AAGGCGGATGAAAAGAAAGGGGG - Intergenic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166329307 19:42069429-42069451 CAGGTGGAAGAGGAGAGGGCGGG + Intronic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1167056387 19:47113503-47113525 CAGCCGAAAGAAAAGCAGCCAGG + Intronic
1167951663 19:53032513-53032535 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1202700502 1_KI270712v1_random:160479-160501 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
925131833 2:1499247-1499269 CAGGCGGAAGGTCAGAGGGCAGG - Intronic
925283587 2:2701701-2701723 AAGGCGGAAGAAAGGGAGACTGG - Intergenic
925955714 2:8961952-8961974 GAGGGGGAAGGAAGGAAGGCTGG - Intronic
926161894 2:10495134-10495156 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
926578091 2:14604840-14604862 CAGGAAGAAGAAAGGAAGACAGG - Intergenic
926762957 2:16295618-16295640 CAGGTGAAAACAAAGAAGGCCGG - Intergenic
927880398 2:26686232-26686254 CAGCCGGAAGAAAAGATGCAGGG - Intergenic
928269499 2:29843415-29843437 CTGCTGGAAGAAAAGAAGGAAGG + Intronic
928269501 2:29843434-29843456 AAGGAGGAAGAAAAGAAGAAAGG + Intronic
928790854 2:34950918-34950940 GAGGAGGGAGAAAGGAAGGCAGG + Intergenic
929477064 2:42261528-42261550 CAATCTGATGAAAAGAAGGCAGG + Intronic
930928544 2:56851689-56851711 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
931138042 2:59426619-59426641 GAGGCTGATAAAAAGAAGGCAGG + Intergenic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
933429038 2:82151168-82151190 AAGAAGGAAGAAAGGAAGGCAGG - Intergenic
934171430 2:89543952-89543974 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934281739 2:91618270-91618292 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934528175 2:95065461-95065483 CATGCTGAACAAAAGAATGCAGG - Intergenic
934903101 2:98176522-98176544 AAGGCAGAAGGAAAGAAGGAAGG - Intronic
935658082 2:105441982-105442004 GAGGTGGAAGATAGGAAGGCTGG - Intergenic
936561059 2:113540450-113540472 GAGGCTGAAGAAAAGAAGAATGG - Intergenic
936641257 2:114314955-114314977 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
937603445 2:123768316-123768338 TAAACGGAAGGAAAGAAGGCAGG - Intergenic
937675078 2:124581134-124581156 GAGGCGGTAGGAAACAAGGCTGG + Intronic
937804846 2:126127319-126127341 CAAGCGGAAGAAAGGATGGAAGG + Intergenic
938266305 2:129930700-129930722 GAGCGGGAAGAAAAGAAGGAAGG - Intergenic
939069105 2:137518165-137518187 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
939781098 2:146449096-146449118 CAGAAGGTAGAAAAGAAGGTTGG - Intergenic
939873045 2:147546409-147546431 GAGCCAGAAGAAGAGAAGGCGGG - Intergenic
940815619 2:158294048-158294070 AAGGCGGAAGGAAGGAAGGAAGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941336038 2:164245065-164245087 CAGGAGGAAGGAAGGAAGGAGGG - Intergenic
941693041 2:168521486-168521508 CAGGTGGAAGAAGAGGAGGAGGG + Intronic
941873847 2:170413406-170413428 GAGGAGGAAGAAATGATGGCAGG + Intronic
942349270 2:175036071-175036093 CAGTGGGGAGAAAAGAAGGAAGG + Intergenic
943280640 2:185928446-185928468 AAGGAGGAAGAGAAGAAGGGAGG + Intergenic
944673074 2:202012257-202012279 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
944932886 2:204538405-204538427 AAGGGGGAAGAAAAGAATCCAGG + Intergenic
945175989 2:207043955-207043977 GGGGAGGAAGAAAAGAAGGAAGG + Intergenic
946049613 2:216851052-216851074 CAGGCAGAAAAAATGAAGCCTGG - Intergenic
946346999 2:219118764-219118786 CAAGCTGAAGGAATGAAGGCTGG + Intronic
947128090 2:226893080-226893102 CATGAAGAAGAAAAGATGGCAGG - Intronic
947752787 2:232541450-232541472 CAGGCGGAACGGAAGATGGCAGG - Exonic
948081746 2:235212143-235212165 CAGGAGGAAGGAAAGAGGGAAGG - Intergenic
948287400 2:236796582-236796604 GAGGAGGAAGACAGGAAGGCAGG - Intergenic
948546864 2:238738878-238738900 AAGGCTAAAGAAAAGAAGTCAGG - Intergenic
948947795 2:241229965-241229987 CAGGCAGAAGACAGGAAGACAGG + Intronic
1168764960 20:375641-375663 CATGTGGAAGGAAAGGAGGCAGG + Intronic
1170113176 20:12827464-12827486 CAGAAGGAAAAAAAGAAGGAAGG + Intergenic
1170405487 20:16031224-16031246 GAGGAGGAAGAAAAGAAGGGAGG + Intronic
1170440703 20:16376309-16376331 CAGGTGGTAGGAAAAAAGGCAGG + Intronic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170573259 20:17644488-17644510 GAGGGGGAAGACAGGAAGGCTGG - Intronic
1170723166 20:18901982-18902004 CAGATGGAAGAAAATAAGGCTGG + Intergenic
1170873693 20:20231652-20231674 CAGGTGACAGGAAAGAAGGCTGG - Intronic
1171389673 20:24793269-24793291 CAGCAGGAAGAGAGGAAGGCAGG + Intergenic
1171906951 20:30907140-30907162 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1172393609 20:34583460-34583482 CAGGCAGAAGAGAAGACAGCAGG + Intronic
1172604547 20:36205927-36205949 CAGCAGGAAGAAAGGCAGGCAGG + Intronic
1173149935 20:40558497-40558519 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1173221500 20:41136532-41136554 GAGGAGGAAGAAAGCAAGGCGGG + Intergenic
1173542216 20:43862680-43862702 CAAGAGGAAGGAAAGAAGGAAGG - Intergenic
1174500190 20:50978666-50978688 GAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1175131317 20:56791803-56791825 CAGGTGGAAGGAAGGAAGGAAGG - Intergenic
1175319921 20:58078417-58078439 CAGGGGGAAGAAGAGAAGAAAGG + Intergenic
1175399972 20:58694437-58694459 CAGGCGGAAGCAAAGACCTCCGG - Exonic
1176551630 21:8225326-8225348 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1176570539 21:8408325-8408347 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1176578448 21:8452492-8452514 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177002094 21:15625670-15625692 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1177206428 21:18016453-18016475 CAGGCAGAAGAAAAAAAGAATGG + Intronic
1177593196 21:23200735-23200757 CAGGAGGAAGGGAGGAAGGCAGG + Intergenic
1177766245 21:25460678-25460700 GAGGAGGAAGAAAACATGGCTGG - Intergenic
1178006016 21:28220167-28220189 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1178152506 21:29811754-29811776 AAGGTGGAAGATAAGCAGGCAGG - Intronic
1178226560 21:30725964-30725986 CAGGTGGAAGAAAAGAAAGATGG + Intergenic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1179061475 21:37983223-37983245 AAGGAGGAAGGAAAGAAGGAAGG - Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180315025 22:11270618-11270640 GAGGCGGGAGGAAAGAAGGAAGG + Intergenic
1180340363 22:11613142-11613164 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1180945055 22:19688255-19688277 CAGGAGGAAGGAAGGAAGCCAGG - Intergenic
1181016047 22:20069502-20069524 AAGGAGGAAGGAAAGAAGGAGGG + Intergenic
1181299710 22:21870883-21870905 CCGGGGGAAAAAAAGATGGCTGG + Intergenic
1181917394 22:26292162-26292184 AAGGAGGAAGGAAAGAAGGAAGG + Intronic
1182100874 22:27656376-27656398 TAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1183161378 22:36115689-36115711 CAGATGGAAGAAAAGATGCCCGG + Intergenic
1183501375 22:38181597-38181619 CAGGGGGATGAAAAGATGGAAGG + Intronic
1184267386 22:43356302-43356324 CTAGAGGAAGAAAAGAAGGAAGG - Intergenic
1203256652 22_KI270733v1_random:142246-142268 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1203290047 22_KI270735v1_random:27930-27952 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1203322959 22_KI270737v1_random:86335-86357 AAGACGGAAGGAAAGAAGGAAGG - Intergenic
949095197 3:77363-77385 CAGGAGGAAGATAAGAAGGAGGG - Intergenic
950024429 3:9810514-9810536 CAGGAGGAAGAAAAGAGGCGTGG + Intronic
950480730 3:13242180-13242202 CTGGAGGAAGTAAAGAAGTCAGG + Intergenic
950635508 3:14311634-14311656 AAGGAGGAAGAAACGAAGGGAGG - Intergenic
950891276 3:16406926-16406948 CAGTGGGAAAAAAAGAATGCTGG + Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951738078 3:25889747-25889769 AAGAAGGAAGAAAAGAAGGCAGG - Intergenic
951896158 3:27611841-27611863 CAGAAGGAAGAAAGGAATGCAGG - Intergenic
951974165 3:28484757-28484779 CAGAAGGAAGACAGGAAGGCAGG - Intronic
952274593 3:31865061-31865083 AAGGGAGAAGAAAAGAAGGGAGG + Intronic
952333782 3:32387600-32387622 CAGGCTGAAATAACGAAGGCAGG + Intergenic
952717770 3:36497735-36497757 CAGGCAGAAAAAAGGAAGGGAGG + Intronic
953098840 3:39806621-39806643 TAGCTGGAAGAAAAGAAGGAAGG + Intergenic
953357398 3:42266561-42266583 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
954584257 3:51720242-51720264 CAGGAGGAAGAAAAGAGGTGTGG - Intergenic
954592609 3:51796498-51796520 CAGAAGGAAGGAAAGAAGGAAGG - Intergenic
954948340 3:54446417-54446439 CAGAGGGAAGAAAAGAAGTAAGG + Intronic
955037321 3:55281804-55281826 GAGGAGGAAGTAAAGAAGGAAGG + Intergenic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956277624 3:67520243-67520265 CAGGAAGAAGTAAAGAAGGAAGG + Intronic
956593321 3:70939681-70939703 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
956764965 3:72477153-72477175 CAGGCAGTAGGAAAGAAGTCAGG + Intergenic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957603174 3:82365301-82365323 ATGGTGGAAGGAAAGAAGGCAGG + Intergenic
958025650 3:88045835-88045857 TAAGCAGAAGGAAAGAAGGCTGG + Intergenic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
959456717 3:106571919-106571941 AAAAAGGAAGAAAAGAAGGCAGG + Intergenic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961494820 3:127284016-127284038 CAGGTGGAAGAAAAGAAGGCTGG + Intergenic
961553503 3:127682006-127682028 CTGGGGGAGGAAAGGAAGGCTGG + Intergenic
961660215 3:128464752-128464774 AGGGAGGAAGGAAAGAAGGCAGG - Intronic
961660286 3:128464976-128464998 AAGGAGGAAGGAAAGAAGCCAGG - Intronic
961662409 3:128476576-128476598 CAGGAGGAAGGAAATAAGCCGGG + Intergenic
962055853 3:131870873-131870895 CAGCCTGAAGAAGAGAAGGCTGG + Intronic
962393990 3:134998920-134998942 CAGGAGGAAGAAGATAAGCCAGG + Intronic
962437783 3:135382644-135382666 CAGAAGGAAGGAAAGAAGGAAGG + Intergenic
962760036 3:138502997-138503019 AAATTGGAAGAAAAGAAGGCTGG - Intronic
963192308 3:142486444-142486466 AAGGAGGAAGAAAGGAAGGCAGG - Intronic
963331785 3:143923107-143923129 CAGGCTGAGGGAGAGAAGGCAGG + Intergenic
963602531 3:147390728-147390750 AGGGCGGAAGGAAGGAAGGCCGG - Intronic
963791574 3:149588197-149588219 CAGGCTGGAGAAAAGATGGAAGG - Intronic
963912999 3:150830910-150830932 CAGGAGGAAGGAAGGAAGGACGG - Intergenic
964040192 3:152252223-152252245 AAGGAGGGAGAAAAGAAGGAAGG - Intronic
964653289 3:159036375-159036397 CAGGTGGAGGAAGAAAAGGCAGG - Intronic
965368184 3:167825118-167825140 CAGGAGGAAGGAAGGAAGGAAGG + Intronic
965908135 3:173736220-173736242 AAGGAGAAAGAAAAGAAGGTAGG - Intronic
967118824 3:186364725-186364747 CCAGCACAAGAAAAGAAGGCTGG + Intergenic
967739648 3:192990978-192991000 AAGGAGGAAGGAAAGATGGCTGG + Intergenic
969586465 4:8097014-8097036 CAGGAGGAAGAAGGGAAGGGAGG + Intronic
969994335 4:11296058-11296080 CAGGGGGAAGAAAAGCGGGTTGG - Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970500625 4:16673050-16673072 CTGGTGAAAGAAAAGAAGGATGG - Intronic
970573480 4:17405232-17405254 AAGGAGGAAGAAATGAAGGAAGG + Intergenic
971481796 4:27121479-27121501 AATGAGGAAGAAAAGGAGGCTGG - Intergenic
971497894 4:27287367-27287389 AAGAAGGAAGAAAAGAGGGCAGG + Intergenic
971508863 4:27399185-27399207 CAGCAGGAAGAAATGAAGGCTGG + Intergenic
971566166 4:28144367-28144389 CAGGTTGCAGAAAAGAATGCTGG - Intergenic
972201275 4:36716918-36716940 CAGGCTGCGGAAGAGAAGGCAGG + Intergenic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
972915981 4:43880434-43880456 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
972924235 4:43983882-43983904 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
973008072 4:45038164-45038186 CAGGCAGTTGAAAAGAAGTCAGG - Intergenic
973118474 4:46489318-46489340 CAGGCTGAGGAAGAGTAGGCAGG - Intergenic
973173527 4:47175052-47175074 AAGGAGGAAGGAAAGAAGGGAGG - Intronic
973832755 4:54778669-54778691 CAGGTTACAGAAAAGAAGGCAGG - Intergenic
975163182 4:71147334-71147356 GAGGAGGATGAAAAGAAGACAGG - Intergenic
975982582 4:80177013-80177035 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
977453515 4:97227861-97227883 CAGGTGCAAGAAAAGGAGGGAGG + Intronic
977466032 4:97383641-97383663 CAGGCTGGAGGAAAGAAGGCAGG - Intronic
977487635 4:97668650-97668672 AAGGAGGAAGGAAAGAAGGGAGG + Intronic
978355762 4:107871515-107871537 AAGGCGGCAGAAGAGAAAGCTGG - Intronic
979767046 4:124474862-124474884 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
980387916 4:132110914-132110936 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
980602232 4:135040287-135040309 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
980629560 4:135414558-135414580 CAGGCCGGGGAAGAGAAGGCAGG - Intergenic
980892329 4:138829228-138829250 CAGGTGGAACAAGAGAAGCCTGG - Intergenic
981036495 4:140174915-140174937 CTGGAGGCAGAAAAGAGGGCAGG + Intergenic
982235667 4:153249256-153249278 CAGGCGGAAGAAAAGAAGGCGGG - Intronic
982740639 4:159053715-159053737 AGGGAGGAAGAAAAGAAGGAAGG - Intergenic
982761903 4:159294682-159294704 CAGACGGACGGAAAGAAGGAAGG - Intronic
983136970 4:164096415-164096437 AAGGAGGAAGAAAGGAAGGAGGG + Intronic
983279887 4:165667039-165667061 CAGGAGGAAGACAGGAAGGAAGG + Intergenic
983730940 4:170992376-170992398 TAGGAGGAAGAAAGGAAGGAAGG - Intergenic
984060250 4:174981758-174981780 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
984149396 4:176108000-176108022 CAGGAGGAAGGGAAGAAGGGTGG - Intronic
984564312 4:181309418-181309440 GAGGAGGAAGAAAAGAAAGAAGG - Intergenic
984863114 4:184257307-184257329 AAGGAGGAAGGAAGGAAGGCAGG + Intergenic
985099702 4:186446715-186446737 CAGGCGGAAGGAAGGAAGGAAGG - Intronic
985208091 4:187562170-187562192 CAGGCAGAAGACAATAAGGGAGG - Intergenic
985588530 5:753115-753137 AAGGGGGACGGAAAGAAGGCAGG - Intronic
985603197 5:845554-845576 AAGGGGGACGGAAAGAAGGCAGG - Intronic
985922758 5:2992381-2992403 CAGGCAGAAGGAAAGAAGTATGG + Intergenic
985945790 5:3181858-3181880 GAGGCGGAAGAAAACAGGGAGGG + Intergenic
986837615 5:11657471-11657493 AGGGAGGAAGAAATGAAGGCAGG - Intronic
986959867 5:13199461-13199483 CAGGCTGGAGGAGAGAAGGCAGG - Intergenic
987551401 5:19386638-19386660 CAAGAGGAAGAAAAGGAGGAGGG + Intergenic
987657108 5:20821384-20821406 CAGGCTGGAGGAGAGAAGGCAGG + Intergenic
987862480 5:23506092-23506114 CAGGAGGAAGAGAGAAAGGCGGG - Intergenic
988188809 5:27901502-27901524 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
988228796 5:28448392-28448414 CAGGCTGAGGAAGAGAAGGCAGG - Intergenic
988331244 5:29843343-29843365 CAGGAAGAAGGAAAGAAGGGAGG + Intergenic
988766443 5:34382564-34382586 CAGGCTGGAGGAGAGAAGGCAGG - Intergenic
989007067 5:36826830-36826852 GAGGGGGAAGGAAAGAAGGAGGG + Intergenic
989178413 5:38553058-38553080 CAGGCAGAAGAAGAGTGGGCTGG - Intronic
989751513 5:44899951-44899973 AATGAGGAAGAAAAGAAGGATGG + Intergenic
990446682 5:55899633-55899655 CAGGCAGAAGGAAATAAGGGTGG + Intronic
990604866 5:57398765-57398787 CAGGCGCTAGAAAAGAACGAAGG - Intergenic
990726871 5:58765943-58765965 CAGGAGGAAGAAGAGTGGGCAGG - Intronic
991204964 5:64039587-64039609 CAGGAGGAAGAAAAGGAGAGAGG - Intergenic
991249152 5:64540794-64540816 CAGGCAGAAGAAAGGAGGGAGGG + Intronic
991524660 5:67542965-67542987 CAGGTGAAATAAAATAAGGCAGG - Intergenic
991664528 5:68985441-68985463 AAGGAGGAAGAAAGGAAGACAGG - Intergenic
991946174 5:71900409-71900431 CAGGCTGGGGAAAAGAAGGCAGG - Intergenic
992390356 5:76325564-76325586 CAGGAGGAAGAAACGCAGGAAGG - Exonic
992823884 5:80528287-80528309 AAGGGGGAAAAAAAGAAGGAAGG + Intronic
993283551 5:85959923-85959945 CAGGCGGAGGGAAGGAAGGAGGG - Intergenic
993432030 5:87843421-87843443 CAGGGGGAATAAAACAAGGAAGG - Intergenic
993971075 5:94420727-94420749 AAGAGGGAAGAAAAGAAGGAAGG + Intronic
994889896 5:105620049-105620071 CAGGAGAAAGAAAATAGGGCAGG - Intergenic
994916991 5:105993744-105993766 CAGGCTGCAGAAAAGAAGTCAGG - Intergenic
995269524 5:110205197-110205219 CAGGCTGGGGGAAAGAAGGCAGG + Intergenic
995616658 5:113972212-113972234 CAGACGGAAGGAAGGAAGGAAGG + Intergenic
996021520 5:118595848-118595870 CAGGAGGCAGAATGGAAGGCAGG + Intergenic
996111482 5:119571301-119571323 AAGGGGGGAGAAAAGAAGGAAGG - Intronic
996621697 5:125512693-125512715 GAGGAGGAAGAAAGGAAGGAAGG - Intergenic
996725289 5:126668961-126668983 CAGGCGGAAGAAGAGAAATCAGG + Intergenic
996781310 5:127189689-127189711 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
997155194 5:131548901-131548923 CAGGGGGAAAAAAATAAGCCAGG + Intronic
997737509 5:136224827-136224849 CAGGCAGAGGAAGAGAAGGGTGG - Intronic
997747326 5:136310590-136310612 CAGTTGGAAGGAAAGATGGCTGG + Intronic
998238320 5:140419885-140419907 CAGACGGAAGGAAGGAAGGAAGG - Intronic
998638896 5:143987410-143987432 GAGGCGGAAGGAATGCAGGCAGG - Intergenic
999018809 5:148140213-148140235 CAGGGAGAAGTAAAAAAGGCAGG + Intergenic
999351414 5:150875113-150875135 CAGGCTGAGGGAGAGAAGGCAGG - Intronic
999654669 5:153800142-153800164 CAGGTGGTAAAAAAGAAAGCTGG - Intronic
999691418 5:154149073-154149095 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
999858989 5:155624801-155624823 GAGGAGGAAGAAGAGAAGGAAGG + Intergenic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000328215 5:160188128-160188150 CACCCGGGAGAAAAGCAGGCAGG + Intronic
1000417001 5:160994167-160994189 CAGGCAGGAGGAGAGAAGGCAGG - Intergenic
1000930843 5:167249445-167249467 GAGGGGGAAGGAAAGAAGGAAGG - Intergenic
1001020522 5:168178631-168178653 CAGGGAGAGGAAAAGAAGGAAGG + Intronic
1001434242 5:171686963-171686985 CAGGTGGCAGAAAACAAAGCTGG + Intergenic
1001743194 5:174070490-174070512 AAGAAGGAAGGAAAGAAGGCAGG - Intronic
1001809308 5:174615166-174615188 CAGCCGTAAGAATAGCAGGCCGG + Intergenic
1002088217 5:176789141-176789163 CCGGTGGAAGGCAAGAAGGCTGG - Intergenic
1002870380 6:1161827-1161849 CAGGAGGAAGAACAGAGGGTGGG + Intergenic
1004682119 6:17906383-17906405 AAGGGGGAAGAAAGGAAGGCAGG - Intronic
1004698796 6:18059165-18059187 GAGGAGGAAGGAAAGGAGGCAGG - Intergenic
1004880196 6:19999913-19999935 CAGGAAGAGAAAAAGAAGGCAGG - Intergenic
1005437670 6:25832427-25832449 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1006062384 6:31433491-31433513 CAGGCTGAGGAAGAGAAAGCAGG - Intergenic
1006399623 6:33809486-33809508 CAGGCGCTAGAACAGGAGGCAGG + Intergenic
1006665706 6:35691484-35691506 CAGGAGGAAGACAGAAAGGCAGG + Intronic
1006826633 6:36940634-36940656 GAGGGAGAAGAAAAGGAGGCGGG + Intergenic
1007107688 6:39294903-39294925 CAAGAGGAAGAAAAAAAGGAGGG + Intergenic
1007874419 6:45079483-45079505 AAGGAGGAAGAAAAAAAGGAAGG + Intronic
1007882621 6:45184625-45184647 AAGGTAGAAAAAAAGAAGGCTGG + Intronic
1008056516 6:46951310-46951332 GAGGGAGAAGAGAAGAAGGCTGG + Intronic
1008369554 6:50716485-50716507 AAGAAGGAAGGAAAGAAGGCAGG + Intronic
1008376221 6:50795063-50795085 TAGGCGAGAGAAAAGAAGCCTGG - Intergenic
1008585227 6:52942642-52942664 CAGGGGGACTAAAAGCAGGCAGG + Intergenic
1008863190 6:56176642-56176664 AAGGAGGAAGAAAGGAAGGAAGG + Intronic
1009751888 6:67886081-67886103 CAGATGGATGAAAAGAAAGCAGG + Intergenic
1010168136 6:72941411-72941433 AAGGAGGAAGGAAAGAAGGGAGG - Intronic
1010323612 6:74540755-74540777 CAGGCTGGAGAAGAGAAGGCAGG - Intergenic
1011494987 6:87928707-87928729 CAGGCTGAAGAAAACAGAGCAGG + Intergenic
1011712505 6:90069004-90069026 CAGAGGGAAGCAAAGAAGGAAGG - Intronic
1011857874 6:91717220-91717242 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1012119906 6:95353853-95353875 AGGGAGGAAGGAAAGAAGGCAGG + Intergenic
1012955140 6:105561913-105561935 CAGGGAGAAAAAAAAAAGGCAGG + Intergenic
1013874157 6:114803734-114803756 CAAATGGAAGAAAAAAAGGCAGG - Intergenic
1014631674 6:123797067-123797089 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1015424395 6:133049261-133049283 AAGGAGGAAGAAAGGAAGGAAGG - Intergenic
1015888617 6:137946447-137946469 CAGGCGGAAGAGAAGAATCCAGG - Intergenic
1016547323 6:145239008-145239030 GAGGGGGAAGGAAAGAAGGAAGG - Intergenic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1016989050 6:149916876-149916898 GAGACGGAAGAAAAGACAGCTGG + Exonic
1017013885 6:150084441-150084463 ATGGAGGAAGAAAGGAAGGCAGG - Intergenic
1017678406 6:156839040-156839062 AAGTAGGAAGAAAAGAAGGCAGG - Intronic
1018437943 6:163779965-163779987 CAGTGGGAATAAAAGAAAGCTGG + Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019106420 6:169671206-169671228 CAGGTGAAAGAAAAAATGGCAGG + Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019609362 7:1929166-1929188 GAGGTGGAAGAAAAGAGGGGAGG - Intronic
1019791586 7:3017479-3017501 GAGGCTGAGGAAAATAAGGCTGG + Intronic
1020232571 7:6331049-6331071 CAGCCTTAAGAAAAGAATGCCGG - Exonic
1020417891 7:7967719-7967741 CACAAGGAAGAAAAGAAGGATGG + Intronic
1020710380 7:11597894-11597916 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
1020950122 7:14664900-14664922 AAGAAGGAAGGAAAGAAGGCAGG + Intronic
1021292247 7:18860682-18860704 AAGACGGAAGAAAGGAAGGAAGG + Intronic
1021450554 7:20779593-20779615 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1021983505 7:26077532-26077554 CAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1022100947 7:27168853-27168875 CCAACGGAAGAAAAGAAAGCAGG + Intronic
1022248960 7:28587908-28587930 CAGGTGGTAGAAAAGCAGTCAGG - Intronic
1023046989 7:36218847-36218869 AAGGTGGAAGAGAAGTAGGCTGG + Intronic
1024040571 7:45550413-45550435 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1024914997 7:54488946-54488968 AAGAAGGAAGAAAGGAAGGCAGG - Intergenic
1026110551 7:67455794-67455816 GAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1026240811 7:68573626-68573648 CGGGAAGAAGGAAAGAAGGCTGG + Intergenic
1026241708 7:68581366-68581388 AAGGAGGAAGGAAAGAAGGAAGG + Intergenic
1026294248 7:69037448-69037470 CAGGAGGAGGAAAAGCAGGTTGG - Intergenic
1026340538 7:69430440-69430462 AAGGAGGAAGAAAGGAAGGAAGG + Intergenic
1026468655 7:70675927-70675949 CAGGCTGAAGGAAAGAAGATGGG + Intronic
1026605934 7:71815807-71815829 AGGGAGGAAGAAAAGAAGGGAGG - Intronic
1026890858 7:73981417-73981439 AAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1028085379 7:86630160-86630182 AAGGCGGAACAAAATGAGGCAGG - Intergenic
1029557858 7:101282797-101282819 CAGGCGGCAGGGAAGGAGGCTGG + Intergenic
1030368785 7:108674294-108674316 CAGGCTGGGGAACAGAAGGCAGG - Intergenic
1030507924 7:110447694-110447716 AAGGGGAAAGAAAAAAAGGCAGG - Intergenic
1030902052 7:115136783-115136805 GAGGAGGAAGGAAAGAAGGAAGG - Intergenic
1031329288 7:120443985-120444007 CAGGAGCAAGGAATGAAGGCAGG - Intronic
1031410342 7:121433896-121433918 CATGAGGAAAATAAGAAGGCTGG + Intergenic
1031629655 7:124032257-124032279 CATTCCGAAGAAAAGAAAGCGGG + Exonic
1031676589 7:124618631-124618653 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
1031899236 7:127392085-127392107 CGGGCGGAAGGAAGGAAGGCAGG + Intronic
1031992292 7:128206348-128206370 CAGGCTGCAGCAAAGAAGGTGGG + Intergenic
1032908109 7:136396094-136396116 GAGGAGGAGGAAAGGAAGGCAGG + Intergenic
1033019419 7:137707615-137707637 CAGGAGGAAGAAAAAGAGGGTGG - Intronic
1034385767 7:150739737-150739759 AAGGAGGAAGAAAAGAAAGAAGG + Intronic
1035776597 8:2191910-2191932 CAGGTGGAAGGAAGGAAGGAAGG - Intergenic
1035791816 8:2313186-2313208 AAGGGGGAAAAAAAGAAGGCTGG - Intergenic
1035800989 8:2408519-2408541 AAGGGGGAAAAAAAGAAGGCTGG + Intergenic
1035973968 8:4286181-4286203 CAGTCGGGAGAAAAGAAAACTGG - Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036576581 8:10033011-10033033 AAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1036601616 8:10265878-10265900 CAGGTGGAATCAAAGAAGCCAGG - Intronic
1036636122 8:10550636-10550658 CAGGCAGGAGAGAGGAAGGCTGG - Intronic
1036650057 8:10636505-10636527 GAGGGGGAAGGGAAGAAGGCGGG - Intronic
1036797515 8:11766981-11767003 GAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1037002104 8:13732388-13732410 CAACAGGTAGAAAAGAAGGCAGG - Intergenic
1037213803 8:16424888-16424910 GAGGAGGAAGTAAAGAAGGAAGG - Intronic
1037426605 8:18762264-18762286 CAGGAGGAAGAGAGGAAGGAAGG - Intronic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037774368 8:21823237-21823259 GGGGAGGAAGAACAGAAGGCAGG - Intergenic
1038492792 8:27982358-27982380 AAGGCGGGAGAAAGGAAGGTGGG + Intronic
1038996706 8:32931312-32931334 CAGGCGGAAAATAATAAGTCAGG + Intergenic
1039272765 8:35900825-35900847 CAGACAGAAGAAAAGAAGGAAGG - Intergenic
1039428561 8:37506687-37506709 AGGGAGGAAGAAAAGAAGGAAGG + Intergenic
1039435984 8:37559560-37559582 GAGGAGGAGGAAAAGAAGGAGGG + Intergenic
1039566374 8:38554888-38554910 CAGGTTGAAGAAACAAAGGCAGG - Intergenic
1040071915 8:43195591-43195613 GAGGAGGAAGAAGAGAAGGAGGG + Intronic
1040101774 8:43512460-43512482 CAGGAGGAAGGGAAGAGGGCAGG - Intergenic
1041023332 8:53659435-53659457 AAGGCGGAGGTAAAGATGGCAGG - Intergenic
1041027630 8:53703394-53703416 CAGGCTTAGGAAAAGCAGGCAGG + Intergenic
1041155747 8:54985245-54985267 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1041775159 8:61515028-61515050 GAGGAGGAAGGAAAGAAGGGAGG + Intronic
1041865980 8:62573529-62573551 AAAAAGGAAGAAAAGAAGGCAGG - Intronic
1042001030 8:64123729-64123751 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1042572346 8:70179411-70179433 CCGGAGGAGGAAAAGAAGGGAGG + Intronic
1043266578 8:78273690-78273712 AAGGAGGAAGAAAAGATGGAGGG - Intergenic
1043336962 8:79187854-79187876 AGGGAGGAAGAAAAGAAGTCTGG + Intergenic
1043824436 8:84908528-84908550 CAGCCTTAAGAAAAGAAGGAAGG - Intronic
1044214615 8:89594540-89594562 AAGGGGGAAGGAAAGAAGGAAGG + Intergenic
1044872024 8:96628861-96628883 AAGGGGGAAGGAAAGAAGGAAGG - Intergenic
1045494966 8:102700472-102700494 CAGGCTGATGGAAAGAAGCCAGG + Intergenic
1046373428 8:113343095-113343117 CAGGAGGAAGAAAAGACTGAAGG + Intronic
1046505075 8:115126546-115126568 CAGGAGGAAAAACACAAGGCAGG - Intergenic
1046869000 8:119183672-119183694 AAGGAGGGAGAAAAGAAGGGAGG - Intronic
1047061796 8:121235620-121235642 AAGGAGGAAGGAAAGAAGGAAGG - Intergenic
1047549037 8:125849985-125850007 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
1047653786 8:126953191-126953213 AAGGAGGAAGAAGAGCAGGCTGG + Intergenic
1048110781 8:131465964-131465986 AAGGCAGTAGAATAGAAGGCAGG + Intergenic
1049237144 8:141518133-141518155 CAGGCGGGAGACCAGGAGGCCGG - Intronic
1049298285 8:141855445-141855467 CAGGGGCAGGAAAAGCAGGCTGG + Intergenic
1049666509 8:143845950-143845972 GAGGCGGAAGACCAGGAGGCAGG - Intergenic
1049891621 9:74879-74901 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1050206736 9:3204446-3204468 CAGGAGAAAAGAAAGAAGGCCGG - Intergenic
1050256290 9:3795655-3795677 TAGGCGGAAAAAAAGAAGAAAGG - Intergenic
1050347930 9:4711209-4711231 CAGGCAGCAGAAAGGAAGGTGGG + Exonic
1050414121 9:5397515-5397537 AAGAAGGAAGAAAAGAGGGCAGG + Intronic
1051345370 9:16146430-16146452 CAGAAGGAAGAAAGGAAGGGAGG - Intergenic
1051720132 9:20028584-20028606 AAGGCGGAAGAAGTGAGGGCAGG - Intergenic
1051764940 9:20513429-20513451 CGGGCGAAAGACAAGATGGCAGG + Intronic
1051785272 9:20735468-20735490 GAGGCGGAAGGAAGGAAGGAAGG - Intronic
1052418750 9:28213462-28213484 CAGGCAGAAGAAAGGCATGCTGG - Intronic
1052877009 9:33575026-33575048 CAGGAGGAAGAGAAGAGAGCAGG - Intergenic
1053498997 9:38569368-38569390 CAGGAGGAAGAGAAGAGAGCAGG + Intronic
1053516528 9:38735071-38735093 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1053733049 9:41075973-41075995 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1054695373 9:68355586-68355608 GAGGCTGAAGAAAAGAAGAATGG - Intronic
1054841656 9:69748223-69748245 GAGGAGCAAGAAAAGATGGCAGG + Intronic
1056156696 9:83845470-83845492 CAGGCTGGAGGAGAGAAGGCAGG - Intronic
1056353842 9:85778057-85778079 CAGGCTGGAGGAGAGAAGGCAGG + Intergenic
1056610304 9:88121613-88121635 CAGGAGGAAGAGAAGAGAGCAGG - Intergenic
1057133932 9:92673281-92673303 AGGCTGGAAGAAAAGAAGGCTGG + Intergenic
1057162048 9:92895703-92895725 CAGGAGGAAGAGAAGACAGCAGG + Intergenic
1057613402 9:96567064-96567086 CAGGCGGGGGGAAAGAAAGCGGG - Intronic
1057678434 9:97153857-97153879 CAGGAGGAAGAGAAGAGAGCAGG + Intergenic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058189536 9:101896041-101896063 CAAATGGAAGAAAAGAGGGCAGG - Intergenic
1058259229 9:102809417-102809439 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1058687994 9:107494678-107494700 CAGGTCAAAGAAAATAAGGCAGG - Intergenic
1058935816 9:109768175-109768197 CAGGAGGGAGTAAAGCAGGCAGG + Intronic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1060510037 9:124224994-124225016 CAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1060956640 9:127646084-127646106 CAGGTGCAAGAAAGGAAGGCTGG - Intronic
1062010842 9:134265833-134265855 CAGAAGGAAGAAATGAAGGTAGG - Intergenic
1203472809 Un_GL000220v1:123950-123972 GAGGCGGGAGGAAAGAAGGAAGG - Intergenic
1203481881 Un_GL000224v1:16031-16053 CAGGAGGAAGGAAGGAAGGAAGG + Intergenic
1203363310 Un_KI270442v1:236502-236524 GAGGCGGGAGGAAAGAAGGAAGG + Intergenic
1185485196 X:476784-476806 CAGGAGGAAAGAAAGAAGGAAGG + Intergenic
1185545016 X:936523-936545 AAGGAGGAAGAAAAGAAAGAAGG - Intergenic
1185834036 X:3328840-3328862 CAGAAGGAAGAAAGGAAGGCAGG + Intronic
1185953635 X:4464696-4464718 GAGGCGGAAGAGAAAAAGGTAGG + Intergenic
1186020076 X:5245211-5245233 AAGGAAGAAGAAAAGAAGGAAGG - Intergenic
1186077576 X:5897882-5897904 GAGGAGGAAGGAAAGAAGGAGGG - Intronic
1186079325 X:5912981-5913003 CAGGAGGAAGGAAGGAAGGAAGG + Intronic
1186239950 X:7555242-7555264 CAGGAGGGAGAGAAGAAGGGAGG + Intergenic
1186384066 X:9091495-9091517 CAGGCTGGGGGAAAGAAGGCAGG + Intronic
1186749466 X:12606781-12606803 CAGAAAGAAGAAAAGAAGGGAGG - Intronic
1186838436 X:13460928-13460950 GAGAGGGAAGAAAAGAAGGAAGG + Intergenic
1187506393 X:19881778-19881800 GGGGTGGAAGAAAAGAAGGGAGG + Intronic
1187604901 X:20872129-20872151 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1187825898 X:23333697-23333719 GAGGAGGAGGAAGAGAAGGCAGG + Intergenic
1188601397 X:31970245-31970267 ATGGAGGAAGAAAAGAAGGGAGG + Intronic
1189913071 X:45830379-45830401 AAGGTGGAGGACAAGAAGGCAGG + Intergenic
1190458518 X:50647607-50647629 AAGGAGGAAGAAAAGAAAACTGG - Intronic
1191108188 X:56785275-56785297 AAGGGAGAAGAAAAGAATGCAGG + Intergenic
1191134003 X:57044222-57044244 CAGGCTGGGGAATAGAAGGCAGG + Intergenic
1191595115 X:62935309-62935331 CAGGGAGAAGAAAAGATGCCTGG + Intergenic
1191658773 X:63629541-63629563 CAGGCTGGAGTAGAGAAGGCAGG + Intergenic
1192169049 X:68843196-68843218 CAGGCGGAGGGAAGGAAGGTTGG + Intergenic
1194179563 X:90695673-90695695 CAGGCTGAGGGAAAGAAGGCAGG + Intergenic
1194284167 X:91989264-91989286 AAAGAAGAAGAAAAGAAGGCCGG + Intronic
1195370100 X:104165392-104165414 CAGGAGGAAGAAGAGAAAGAGGG - Intergenic
1195529882 X:105941907-105941929 GAGGGGGAAGTAAAGAAGGATGG - Intronic
1195809756 X:108816584-108816606 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1196135934 X:112209576-112209598 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1196852318 X:119949156-119949178 AAGGAGGAGGAAAAGAAGGGGGG - Intergenic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1199250912 X:145660419-145660441 CAGGAGGAAGAGAAAAAGGCGGG - Intergenic
1199267334 X:145843823-145843845 CAGGCAGAAGGTAAGCAGGCAGG + Intergenic
1199362545 X:146939857-146939879 CAGGAGGAAGGAAGGAAGGAAGG - Intergenic
1199444137 X:147901296-147901318 CAGGCAAGAGAAAATAAGGCTGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1200226657 X:154421281-154421303 CAGGAGGGAGCATAGAAGGCAGG + Exonic
1200521301 Y:4212291-4212313 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1200526223 Y:4277846-4277868 CAGGCTGAGGGAAAGAAGGTAGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201637612 Y:16142754-16142776 AAGGCGGAAGAAAATAAAGGAGG - Intergenic
1201907412 Y:19099900-19099922 TAGGAGGAAGAAAAGTAGGGAGG - Intergenic
1202196285 Y:22301098-22301120 AAGACAGAAGAAAAGAAGGAAGG + Intergenic