ID: 982235668

View in Genome Browser
Species Human (GRCh38)
Location 4:153249257-153249279
Sequence TCAGGCGGAAGAAAAGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 478}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235668_982235675 2 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235675 4:153249282-153249304 GCAGCTCGGCTCCCGCCTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 123
982235668_982235683 27 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235668_982235678 7 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235678 4:153249287-153249309 TCGGCTCCCGCCTCGGGGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 100
982235668_982235674 1 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235674 4:153249281-153249303 CGCAGCTCGGCTCCCGCCTCGGG No data
982235668_982235684 28 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235668_982235676 5 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235676 4:153249285-153249307 GCTCGGCTCCCGCCTCGGGGCGG 0: 1
1: 0
2: 2
3: 20
4: 147
982235668_982235677 6 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235677 4:153249286-153249308 CTCGGCTCCCGCCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 28
4: 172
982235668_982235673 0 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235673 4:153249280-153249302 GCGCAGCTCGGCTCCCGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 282
982235668_982235682 20 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235682 4:153249300-153249322 CGGGGCGGGGCCTGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235668 Original CRISPR TCAGGCGGAAGAAAAGAAGG CGG (reversed) Intronic
900163225 1:1234395-1234417 TCAGGAGGAAGAAACGGGGGCGG + Exonic
900324454 1:2101398-2101420 TCAAGGGAAAGAAAGGAAGGAGG - Intronic
902891552 1:19447967-19447989 TCAGTGTGAAGAAAAGAGGGCGG + Intronic
903954880 1:27018431-27018453 TCAGATGGAAGTAAAGAGGGAGG - Intergenic
904311187 1:29630682-29630704 GGAGGAGGAAGAGAAGAAGGAGG - Intergenic
904775432 1:32903001-32903023 TCAGGTGGAAGGGAAGATGGGGG + Intergenic
905193401 1:36254723-36254745 TCTGGGGGAAAAAAAGAAGTTGG + Intronic
905319039 1:37102778-37102800 AGAAGAGGAAGAAAAGAAGGAGG + Intergenic
906789873 1:48649781-48649803 TGAGGAGGAGGAAGAGAAGGAGG + Intronic
906936025 1:50214739-50214761 GCATGCTGCAGAAAAGAAGGCGG + Intergenic
907294650 1:53442578-53442600 GCAGGAGGAAGAAAAGAGAGTGG - Intergenic
907632801 1:56100634-56100656 ACAGCAGGAAGAAAAGAAAGGGG + Intergenic
908449999 1:64244593-64244615 CCAGGCAGAAGAAATGATGGAGG - Intronic
908535659 1:65074576-65074598 TCAGAAGGAAAAAAAGAATGAGG - Intergenic
909030184 1:70530227-70530249 TCAGAAGAAGGAAAAGAAGGAGG - Intergenic
910673070 1:89792683-89792705 GCAGGAGGAAGAAAGCAAGGTGG + Intronic
910790360 1:91044016-91044038 GCAGGCTGGAGAAGAGAAGGTGG - Intergenic
911965894 1:104371180-104371202 ACAGAAGGAAGAAAAGAAGTAGG - Intergenic
911967436 1:104385882-104385904 CCAGGAGGAAGAAAAGAAATTGG - Intergenic
912386321 1:109272915-109272937 TGAGGAGGAAGAAGAGGAGGAGG + Exonic
912601351 1:110936667-110936689 ACAGGAGGAAAGAAAGAAGGAGG + Intergenic
913205843 1:116538015-116538037 TCAGGAGGAGGAGAAGATGGGGG - Intronic
915211430 1:154312579-154312601 ACTGGGGGAAGGAAAGAAGGGGG + Intergenic
915348439 1:155209705-155209727 TGAGGAGGAAGAGGAGAAGGGGG - Intronic
915554317 1:156652927-156652949 GCAGGGGGAAGAAAAGGAGTAGG - Intronic
915663054 1:157419632-157419654 TCATGAAGAAGAAAAAAAGGGGG - Intergenic
917211519 1:172636593-172636615 GCAGGAGGAAGATAAGAGGGAGG - Intergenic
917457194 1:175195055-175195077 TTATGCAGAAGAAAAGAAGTGGG + Intergenic
919399065 1:197086263-197086285 GAAGGGGGAAGAAAAAAAGGAGG + Intronic
920702650 1:208229556-208229578 TCAGGAGGTAGTGAAGAAGGAGG + Intronic
920748502 1:208651659-208651681 TCGGTGGGAAGAAAAGAAGTCGG - Intergenic
921763905 1:218948085-218948107 TCAGCAGGAAGAAAAGGAGGTGG - Intergenic
922381127 1:225027613-225027635 TCAGGAGGAAGAGATGTAGGGGG + Intronic
923999871 1:239538817-239538839 TCAGGCATAACAAAAGTAGGAGG - Intronic
1064234273 10:13559629-13559651 TCAGGTTGAAGACAAGAAGGAGG - Intergenic
1064305154 10:14158785-14158807 GCAGGAGGAAGAAGAGAAGAAGG + Intronic
1064850833 10:19707005-19707027 GAAGGAGGAAGAGAAGAAGGAGG - Intronic
1064884607 10:20096545-20096567 GCAGGTGGAAGAGAAGAAAGAGG + Intronic
1066648815 10:37636757-37636779 ACAGGCAGATGAAAAGGAGGGGG + Intergenic
1067228619 10:44391535-44391557 TCAGGCAGAAGACCACAAGGCGG - Intergenic
1067970160 10:50960662-50960684 TCAAGGGAAAGGAAAGAAGGTGG - Intergenic
1068061089 10:52068377-52068399 TTAGGGGAAAGAAAGGAAGGTGG - Intronic
1068510056 10:57954403-57954425 TGAGGAGGAGGAGAAGAAGGAGG - Intergenic
1068776594 10:60874171-60874193 ACAGGCCGAAGAAAAGACTGAGG + Intronic
1070511651 10:77166665-77166687 AGAGGAAGAAGAAAAGAAGGAGG + Intronic
1070915999 10:80155092-80155114 TCAAGCAGAAGAAAACAAGTTGG + Exonic
1071965036 10:90843705-90843727 AAAGGTGGAAGAAAAGAAAGGGG + Intronic
1073220996 10:101873813-101873835 TCAGCCATAAAAAAAGAAGGAGG - Intronic
1073662129 10:105488258-105488280 TCAGGTGGAAGAAATTGAGGTGG + Intergenic
1074440184 10:113471217-113471239 TCAGAGGGAAGAAAGGAAGAGGG - Intergenic
1075066377 10:119291629-119291651 GGAGGAGGAAGAAGAGAAGGAGG - Intronic
1075066385 10:119291668-119291690 TGAGGAGGAAGAAGAGAAGGAGG - Intronic
1075066406 10:119291785-119291807 TGAGGAGGAAGAGAAGAAGGAGG - Intronic
1075400897 10:122160740-122160762 TAAAGCTGAAGAAAATAAGGAGG - Intronic
1075947284 10:126445999-126446021 TCAGGGGGAAGAATGGGAGGGGG + Intronic
1076016515 10:127032133-127032155 ACAGGCCGAAGCAAAGAAGCTGG + Exonic
1076192716 10:128494187-128494209 GAAGGAGGAAGAAAAGGAGGAGG + Intergenic
1076252355 10:128994616-128994638 GCAGGAGGAAGGAAAGAAGGAGG + Intergenic
1076343369 10:129764916-129764938 TCAGGAGGAAGGGAGGAAGGGGG + Intronic
1076572443 10:131441426-131441448 GAAGGAGGAAGAAAGGAAGGGGG + Intergenic
1076599075 10:131645588-131645610 AAAGGAGGAAGAGAAGAAGGAGG - Intergenic
1076627132 10:131829077-131829099 TCTGGCAGAAGAAAAGTAAGTGG - Intergenic
1078417318 11:11176469-11176491 TCAGGCTGAGGGAAGGAAGGTGG + Intergenic
1078459994 11:11507426-11507448 AGAGGAGGAAGAAGAGAAGGAGG - Intronic
1078477862 11:11648116-11648138 TGAGGAGGAAGAAGAGGAGGAGG - Intergenic
1080329491 11:31119052-31119074 ACAGGAGGAAGAAAAGGTGGTGG + Intronic
1081248730 11:40802536-40802558 TAAGGAGGAAGAAAAGAAAGAGG + Intronic
1082611607 11:55305636-55305658 AAAGCCGGAAGAAAAGTAGGAGG + Intergenic
1082828077 11:57595835-57595857 TCAGCCAAAGGAAAAGAAGGTGG - Intergenic
1083427798 11:62597791-62597813 CCAAGCAGAAGAAGAGAAGGAGG - Intronic
1083968892 11:66060282-66060304 TCAGGAGGTAGAAAAGAACATGG + Intronic
1084272565 11:68037008-68037030 TCAGGCTGAAGAACAGCAAGTGG + Intergenic
1084335813 11:68457268-68457290 TCAGGAGGAAAGACAGAAGGTGG + Intergenic
1084655847 11:70517701-70517723 TCAGGGGGAGGGAAGGAAGGTGG + Intronic
1085391169 11:76183052-76183074 TGAGGAGGGAGACAAGAAGGCGG - Intergenic
1085703190 11:78763378-78763400 AAAGGGGGAAAAAAAGAAGGGGG + Intronic
1085778094 11:79383998-79384020 CCATGGGGAAGAAAGGAAGGGGG - Intronic
1086048830 11:82565091-82565113 ACAGGAGGAAGGGAAGAAGGAGG + Intergenic
1086698260 11:89869030-89869052 AAAGCCGGAAGAAAAGTAGGAGG - Intergenic
1086707904 11:89975458-89975480 AAAGCCGGAAGAAAAGTAGGAGG + Intergenic
1086715400 11:90055694-90055716 AAAGCCGGAAGAAAAGTAGGAGG - Intergenic
1086963616 11:93005679-93005701 TCATGAGGAAGAAGAGGAGGAGG + Intergenic
1087120066 11:94564298-94564320 GCAGGAGGAAGATAAGAGGGGGG - Intronic
1087524237 11:99287831-99287853 GAAGGAGGAGGAAAAGAAGGGGG + Intronic
1087600730 11:100311618-100311640 TCTGGCTGAAGAAACTAAGGAGG + Intronic
1087645103 11:100799841-100799863 TAAGGTGGAAGAAAAGAAAGAGG + Intronic
1087746766 11:101956553-101956575 ACAGGCTGAAGAAAAGGATGTGG - Intronic
1088160686 11:106866274-106866296 ACAGGAGGAAGAAAAGGGGGAGG + Intronic
1088771806 11:113042959-113042981 TGATGAGGAAGAAGAGAAGGAGG - Intronic
1089103119 11:115980802-115980824 TCAGGCTGAAGAGAAGGAGAAGG - Intergenic
1089175809 11:116547988-116548010 GCAGGAGGGAGAAAAGAGGGAGG - Intergenic
1089409852 11:118231609-118231631 TTAGGAGGAAGAACAGAAGTTGG - Intronic
1090431202 11:126648114-126648136 GCAGGAGGAAGAAGTGAAGGAGG - Intronic
1090502957 11:127279694-127279716 GGAGGGGGAAGAAGAGAAGGAGG - Intergenic
1090987900 11:131788752-131788774 TAAGTTGGAAGAAAAGAAAGTGG - Intronic
1091593647 12:1860313-1860335 TCAGGGAGGAGACAAGAAGGCGG - Intronic
1091687244 12:2572326-2572348 GGAGGAGGAAGAAGAGAAGGAGG - Intronic
1091687258 12:2572388-2572410 GGAGGAGGAAGAGAAGAAGGAGG - Intronic
1091687322 12:2572675-2572697 GAAGGAGGAAGAGAAGAAGGAGG - Intronic
1093113942 12:15186565-15186587 GGAGGAGGAAGAAGAGAAGGTGG + Intronic
1093113944 12:15186580-15186602 GAAGGTGGAAGAAGAGAAGGAGG + Intronic
1093713077 12:22350075-22350097 ACAAGAGGAAGAAGAGAAGGAGG + Intronic
1094488439 12:30943200-30943222 TCTGGCGGAAGCTAAGAATGAGG - Intronic
1096125185 12:49113959-49113981 TTTTGGGGAAGAAAAGAAGGGGG - Intergenic
1096587977 12:52636128-52636150 TCAGGGGAAAGAAGAGAAGGAGG - Intergenic
1096756941 12:53807553-53807575 CCAGGCTGAAGAGAAGAATGAGG - Intergenic
1096882558 12:54684717-54684739 TAAGGGGGAAGAATAGAAGGAGG + Intergenic
1097390394 12:59005147-59005169 TGAAGCTGAAGAAAAAAAGGTGG + Intergenic
1098144653 12:67486400-67486422 TGAGGAGGAAGAAGAGCAGGAGG - Intergenic
1098891155 12:76011836-76011858 GCAGGAAGAAGAAAAGATGGAGG - Intergenic
1099685343 12:85880293-85880315 TCAGGATAAAGAAGAGAAGGGGG + Intronic
1099920639 12:88953111-88953133 TCAGGCAGAAGAAGAGACTGAGG + Intergenic
1100301924 12:93315385-93315407 CCAGGCGGAAGGAAAGAATGCGG + Intergenic
1100356186 12:93832601-93832623 TAAAGCTGAAGAAAACAAGGTGG - Intronic
1100841058 12:98612220-98612242 TCAGGGGGAAAAAAAAAAAGGGG - Intergenic
1101725976 12:107388515-107388537 AGAGGAGGAAGGAAAGAAGGAGG - Intronic
1101917476 12:108907137-108907159 GCAGGAGGAGGAGAAGAAGGAGG - Intergenic
1102372485 12:112393760-112393782 TCAGGAGGCTGAAAAGCAGGAGG + Intergenic
1102737846 12:115179099-115179121 GGAGGAGGAGGAAAAGAAGGAGG + Intergenic
1103204047 12:119114343-119114365 CCACTCGGAAGAAGAGAAGGAGG + Exonic
1104459359 12:128942151-128942173 TCAGGCAGCAGGAAGGAAGGTGG + Intronic
1104512091 12:129390215-129390237 TCAGGCACAAAAAAAGACGGAGG - Intronic
1105683384 13:22752393-22752415 CCAGAGGGAGGAAAAGAAGGTGG - Intergenic
1106210968 13:27645172-27645194 AGAGGCGGAAGGAATGAAGGAGG - Intronic
1106506814 13:30377508-30377530 TCTGGGGGAAGAAAAGAACAGGG + Intergenic
1107209473 13:37836132-37836154 TCAGGCAGAAGGCAAGGAGGAGG - Intronic
1108180136 13:47832605-47832627 CCAGGAGGAAGAAGAGAAGTGGG - Intergenic
1110717305 13:78720975-78720997 TTAGGGGAAGGAAAAGAAGGAGG + Intergenic
1111609287 13:90582522-90582544 TGAGGAGTAAGAAAAGCAGGAGG + Intergenic
1112477243 13:99742962-99742984 TAAAGCAGAAGAAAAGAAGAGGG - Intronic
1113050908 13:106211004-106211026 AAAGGAGGAAGGAAAGAAGGGGG + Intergenic
1113303861 13:109054899-109054921 GAAGGAAGAAGAAAAGAAGGAGG - Intronic
1115270783 14:31549949-31549971 GCAGGAGGAGGAAGAGAAGGAGG - Intronic
1117129082 14:52666628-52666650 TCAGGAGAAACAAAGGAAGGAGG + Intronic
1118171585 14:63394562-63394584 TAAGGCGGAAGCAAGCAAGGCGG - Intronic
1118773723 14:68960120-68960142 TGAGGAGGAGGAGAAGAAGGAGG + Intronic
1118884184 14:69852989-69853011 GCAGGGGGAAAAAAATAAGGGGG - Intergenic
1119158441 14:72432656-72432678 TCAGGCGGTAGAACAGAAGAAGG + Intronic
1120410489 14:84148141-84148163 TATGGTGGAGGAAAAGAAGGGGG + Intergenic
1121803175 14:96792493-96792515 TCAGGAGGAAGAAAAGAAGAAGG + Intergenic
1123468265 15:20531658-20531680 GCAGTCGGATGGAAAGAAGGGGG + Intergenic
1123649851 15:22469406-22469428 GCAGTCGGATGGAAAGAAGGGGG - Intergenic
1123728582 15:23126868-23126890 ACAGTCGGATGGAAAGAAGGGGG + Intergenic
1123740252 15:23278225-23278247 ACAGTCGGATGGAAAGAAGGGGG - Intergenic
1123746746 15:23324333-23324355 ACAGTCGGATGGAAAGAAGGGGG + Intergenic
1124035646 15:26051591-26051613 GCAGGAGGAAGGAAGGAAGGAGG - Intergenic
1124279013 15:28347649-28347671 ACAGTCGGATGGAAAGAAGGGGG + Intergenic
1124303685 15:28563959-28563981 ACAGTCGGATGGAAAGAAGGGGG - Intergenic
1125353783 15:38794909-38794931 TCAGAAGGAAGAAAAGAGAGAGG + Intergenic
1126015987 15:44351274-44351296 TCAGACGAAAGAAAGAAAGGTGG + Intronic
1126297497 15:47156971-47156993 TCTGGAGGAAGAAGGGAAGGAGG + Intergenic
1128185204 15:65638807-65638829 TGAGGGGGAAGAAAGGAGGGAGG + Intronic
1128304210 15:66587233-66587255 TAAGGAGGAAGAGAAGGAGGAGG - Intronic
1130338164 15:82975522-82975544 TCAGCCGTAAAAAAAGAATGAGG + Intronic
1130891491 15:88137419-88137441 TCATGCGGAAGAGAGGAAGCTGG + Exonic
1131101484 15:89693657-89693679 TCAGGAGCAAGACAAGATGGTGG + Intronic
1131547755 15:93330138-93330160 TGAGGCAGAAGAAGAGATGGAGG + Intergenic
1132481577 16:168876-168898 TCAGGGGGAAGCAAAGAGTGAGG - Intergenic
1133472824 16:6092099-6092121 TCAGGCTGAAGAAAATAGAGAGG - Intronic
1133908488 16:10042907-10042929 ACAGACGGAAGGGAAGAAGGTGG + Intronic
1135161764 16:20102706-20102728 GCAGGAGGAAGAAGAGGAGGAGG - Intergenic
1135170399 16:20178674-20178696 TTAGGGGGAAGATTAGAAGGTGG - Intergenic
1135236728 16:20763736-20763758 TCAGAAGGAAGAACAGATGGAGG - Exonic
1135655167 16:24242115-24242137 TCAGGCAGAAGATCATAAGGTGG + Intergenic
1135887369 16:26322896-26322918 GCTGGAGGAAGAAAAGAATGTGG + Intergenic
1135910620 16:26557556-26557578 TGAGGGGTAAGGAAAGAAGGGGG - Intergenic
1135934755 16:26770385-26770407 GGAGGAAGAAGAAAAGAAGGAGG + Intergenic
1135996760 16:27255682-27255704 GAAGGAGGAATAAAAGAAGGTGG - Intronic
1136041648 16:27584162-27584184 GGAGGAGGAAGCAAAGAAGGAGG - Intronic
1136901046 16:34038460-34038482 ACAGAAGAAAGAAAAGAAGGAGG + Intergenic
1137557110 16:49477473-49477495 GAAGGAGGAAGAAAAGAAGAAGG + Intergenic
1138600511 16:58051406-58051428 TTTGGTGGAAGAAAGGAAGGAGG + Intergenic
1139238444 16:65365052-65365074 TCAGAAGGAAGAAATGATGGTGG - Intergenic
1139390395 16:66603921-66603943 TCAGGTGGAAGGAAAGGAGGGGG + Intronic
1139559249 16:67731167-67731189 TCAGGGGGAAGGAAACAAGCAGG + Intronic
1139589205 16:67924088-67924110 TCAGGCTGAACACAAGAAGGTGG - Intronic
1140705308 16:77623502-77623524 TCAGGGGGAAGAAAAAAAAAAGG - Intergenic
1140862621 16:79031368-79031390 TAATCCTGAAGAAAAGAAGGAGG - Intronic
1141123718 16:81384857-81384879 TCAGGAGGAAGAAGATGAGGAGG + Exonic
1141597800 16:85107943-85107965 TCAGCCTGCAGAAAAGGAGGAGG + Exonic
1142387256 16:89773682-89773704 ACACACGGAAGAAAACAAGGAGG + Intronic
1143987086 17:10924092-10924114 TCTGGAGAAAGAAAGGAAGGGGG - Intergenic
1144321736 17:14129870-14129892 ACAGGCTGAAGAAAAGAAATGGG - Intronic
1146657638 17:34644410-34644432 TCAGGCGAAAGAAGAGAAAAAGG + Intergenic
1147534894 17:41314192-41314214 TCAGGCAGAAGAAACGTAGCTGG + Intergenic
1148574529 17:48700129-48700151 GGAGGAGGAAGAAGAGAAGGAGG + Intergenic
1149013293 17:51880205-51880227 TCAGGAGGAATAAAGGGAGGAGG - Intronic
1150493598 17:65591071-65591093 TCAGGTGGAAGAATCAAAGGAGG - Intronic
1150605777 17:66689575-66689597 CCAAGAGGAAGAAGAGAAGGAGG - Intronic
1151146492 17:72046452-72046474 GCAGGCTGAAGCACAGAAGGTGG + Intergenic
1151267490 17:72967999-72968021 TCAGGAGGTGGAGAAGAAGGAGG - Intronic
1151953025 17:77365706-77365728 GCAGGTGGAAGGAAAGAGGGTGG - Intronic
1152383787 17:79956749-79956771 TCAGGATGAAGAAAAGCAAGAGG - Intronic
1153110177 18:1577380-1577402 TCAGGGGAAAGAAAAGAATATGG - Intergenic
1153416684 18:4853520-4853542 TGAGGAGGAAGAGAACAAGGAGG + Intergenic
1154478137 18:14787592-14787614 TCAGGAGAAAGAAAAGCATGAGG + Intronic
1156960382 18:43021654-43021676 GCAGGAGGAAGAGATGAAGGAGG - Intronic
1158254073 18:55525879-55525901 TGAGGCAAAAGAAAACAAGGTGG + Intronic
1158423147 18:57313579-57313601 TCAGGAGGAGGAAAAGGAAGGGG + Intergenic
1159329089 18:66965804-66965826 TGAGGGGGAAGTAAAGAAGATGG - Intergenic
1159688055 18:71448217-71448239 TAAGGAGGAAGAAAAGCAAGAGG - Intergenic
1160201054 18:76795728-76795750 TCATGCAGAAGGAAGGAAGGAGG + Intronic
1163342066 19:16715138-16715160 GAAGGAGGAAGAACAGAAGGAGG - Intergenic
1163594116 19:18211039-18211061 TGAGGAGGAAGAAGAGGAGGGGG - Exonic
1164250129 19:23468694-23468716 TGAGGAGGAAGAGGAGAAGGAGG - Intergenic
1164680479 19:30130980-30131002 GAAGGCGGATGAAAAGAAAGGGG - Intergenic
1168099058 19:54131327-54131349 ACAGGCGGCAGAGAAGAAGGTGG + Exonic
1168342381 19:55632601-55632623 TCAGGAGGAGGCAAAGAAAGAGG + Intergenic
925816690 2:7759187-7759209 TCAGGTGGGGGAAAAGAAGAAGG - Intergenic
926087755 2:10030672-10030694 GCAGGTGGATGGAAAGAAGGGGG + Intergenic
926174408 2:10576703-10576725 GCTGGCGGATGAAAAGATGGGGG + Intronic
927464002 2:23323616-23323638 GGAGGGGGAAGAAAAAAAGGGGG + Intergenic
927880399 2:26686233-26686255 TCAGCCGGAAGAAAAGATGCAGG - Intergenic
927989637 2:27438654-27438676 GCAGGAGGTAGAAAAGGAGGCGG + Intronic
929801991 2:45112173-45112195 TTAGGGGGAAGTAGAGAAGGAGG + Intergenic
930272840 2:49276802-49276824 TGAGTCGGAAGAAAACCAGGAGG + Intergenic
931227454 2:60344273-60344295 GGAGGAGGAAGAAGAGAAGGAGG + Intergenic
932127428 2:69156664-69156686 GCAGGAGGAAGAGAAGAACGAGG + Intronic
933619366 2:84519647-84519669 AGAGGAGGAAGAAAAGAAGAAGG - Intronic
933978895 2:87534561-87534583 ACAGGGGGAAAAAAGGAAGGAGG - Intergenic
935175787 2:100647787-100647809 TCAGGGGGATGAAAAAGAGGGGG - Intergenic
935383373 2:102476688-102476710 TAAGGAGAAAGAGAAGAAGGAGG + Intronic
935705053 2:105849385-105849407 TCAGAAAGAAGGAAAGAAGGAGG + Intronic
936895186 2:117419858-117419880 TGTGGCGGAAGAAGAGAAGAAGG + Intergenic
936916745 2:117647561-117647583 TTGGTGGGAAGAAAAGAAGGAGG + Intergenic
937463783 2:122111699-122111721 TCAGGAAGAAGGAAAGAGGGGGG - Intergenic
937573349 2:123390952-123390974 GGAGGAGGAAGAAAAGGAGGAGG - Intergenic
937585249 2:123539517-123539539 AAAGGTGGAAGAGAAGAAGGGGG - Intergenic
938025185 2:127941550-127941572 TCAGGCAGAAGAACCGAATGGGG + Exonic
939614597 2:144348240-144348262 TCAGGCGGAAGCTATGAGGGTGG - Intergenic
939692757 2:145285990-145286012 TCAGCTGGAAGAGAAGAGGGAGG - Intergenic
940163136 2:150736120-150736142 TAAGGCAGAAGAAAAGAAAATGG + Intergenic
941336039 2:164245066-164245088 ACAGGAGGAAGGAAGGAAGGAGG - Intergenic
941693040 2:168521485-168521507 CCAGGTGGAAGAAGAGGAGGAGG + Intronic
942686032 2:178533018-178533040 TGAGATAGAAGAAAAGAAGGAGG - Exonic
943675372 2:190711574-190711596 TCAGGTGGAACAAAGGAATGTGG - Intergenic
944229353 2:197377462-197377484 GCAGGGGAAAGAAAAGAGGGAGG - Intergenic
946921475 2:224585369-224585391 TCAGGCGGAGGAGGAGAAGGAGG - Intronic
947030170 2:225783399-225783421 GAAGGGGGAAGAAAGGAAGGGGG - Intergenic
947838565 2:233192318-233192340 TGAAGCGGAAGAAACAAAGGAGG - Intronic
948170541 2:235898294-235898316 GCAAGGGGAAAAAAAGAAGGGGG - Intronic
948539001 2:238672360-238672382 GGAAGGGGAAGAAAAGAAGGAGG - Intergenic
948710316 2:239821194-239821216 TCAGGAGGAAGAAAACACGCAGG + Intergenic
1168953352 20:1817564-1817586 ACAGGAGGAAAAAAAGAAGTAGG - Intergenic
1169793677 20:9438616-9438638 TCAGGTGGAGAAGAAGAAGGAGG + Intronic
1170472855 20:16685616-16685638 TCAGGGCTAAGAAGAGAAGGGGG - Intergenic
1170488407 20:16844330-16844352 GCAGAAGGAAGAAAAGGAGGAGG + Intergenic
1172730383 20:37082172-37082194 TGAGGAGGAGAAAAAGAAGGAGG - Intronic
1172815818 20:37685130-37685152 ACAGGAGGAAGAAGAGGAGGAGG + Intergenic
1172953014 20:38734111-38734133 TGAGGAGGAGGAAGAGAAGGAGG - Intergenic
1173434143 20:43017375-43017397 TTGGGCGGAAGCAGAGAAGGAGG - Intronic
1173610246 20:44361929-44361951 TCAGCCGGGAGAAGAGACGGTGG + Intronic
1173895987 20:46551029-46551051 TCAGGCTAAAGACAGGAAGGGGG - Intergenic
1174416641 20:50371888-50371910 TTAGGCGGAACAAAAAAAGCGGG + Intergenic
1174430973 20:50468656-50468678 TCAAGAAGAAGAGAAGAAGGAGG - Intergenic
1174736800 20:52972710-52972732 GGAGGAGGAAGAAAAGAAGGAGG + Exonic
1175184728 20:57172428-57172450 ACAGGGACAAGAAAAGAAGGAGG + Intronic
1175835495 20:61991321-61991343 TGAGGCAGAAGAAAACCAGGAGG + Intronic
1176585829 21:8584451-8584473 AAAGACGAAAGAAAAGAAGGAGG + Intergenic
1178092081 21:29174736-29174758 TCAGGCAGAAAAGGAGAAGGTGG + Exonic
1178386915 21:32159836-32159858 TCAGGTGAAAGAAAAGATTGTGG + Intergenic
1178691550 21:34754318-34754340 TGAGGCAGAAAAAAAGAAAGGGG - Intergenic
1179075875 21:38121292-38121314 ATAGGCGGAAGAAAAGAGTGAGG + Exonic
1180268637 22:10561350-10561372 AAAGACGAAAGAAAAGAAGGAGG + Intergenic
1181016046 22:20069501-20069523 GAAGGAGGAAGGAAAGAAGGAGG + Intergenic
1181603606 22:23966868-23966890 TCTGGCGGAAGAAAAGCTGGGGG - Intergenic
1181604907 22:23974439-23974461 TCTGGCGGAAGAAAAGCTGGGGG + Exonic
1181761507 22:25061954-25061976 ACAGGAGGAAGAGAAGAGGGAGG - Intronic
1182011331 22:27003200-27003222 GGAGGGGGAAGAAAAGAGGGAGG - Intergenic
1182739916 22:32560285-32560307 TAAGGCAGAGGGAAAGAAGGAGG - Intronic
1183266086 22:36826478-36826500 TCAGGGGGAAGAAACCCAGGAGG - Intergenic
1185022968 22:48391126-48391148 TCAGGCTGAAGATAAGATGAAGG + Intergenic
949095198 3:77364-77386 GCAGGAGGAAGATAAGAAGGAGG - Intergenic
949394112 3:3596612-3596634 CCAGCCTGAAGAAGAGAAGGAGG - Intergenic
949654803 3:6205804-6205826 AGAGGGGGAAGAAAAAAAGGTGG - Intergenic
950401658 3:12773729-12773751 TCAGAAGGAAGAAAAGGAGCAGG + Intergenic
950534481 3:13571186-13571208 TGAGGAGGAAGAAGAGGAGGAGG + Exonic
950687298 3:14627705-14627727 TTAGGGGGAAAAAAAGGAGGAGG + Intergenic
952332133 3:32373854-32373876 TGAGGAGGAAGAAAAGATGCTGG - Intergenic
952606837 3:35157916-35157938 TCAGGGGGAAGAACCGAAGAAGG - Intergenic
953374281 3:42415694-42415716 TGGGGAGGAAGAAGAGAAGGAGG + Intergenic
953947046 3:47158446-47158468 TGAGGAGGAAGAAGAGGAGGGGG - Intronic
953968084 3:47325654-47325676 TCAGGGGGAAAAAAAGCAGCGGG - Intronic
955696258 3:61640415-61640437 TCAGGAGAAAGAAGAGGAGGAGG - Intronic
956714481 3:72066429-72066451 CCATGAGGAAGAAAAGAACGTGG + Intergenic
956733339 3:72216791-72216813 CCAGGTGGAAGTACAGAAGGTGG + Intergenic
957389528 3:79545994-79546016 CCAGGAGGAAGAGAAAAAGGGGG - Intronic
957603180 3:82365343-82365365 TAAGGCAGAAAGAAAGAAGGAGG + Intergenic
958141061 3:89562811-89562833 TCAGGCTGGAGAAAAAAAGGAGG + Intergenic
958503021 3:94938139-94938161 GCAGGAGGAAGAAAAGGAGGCGG - Intergenic
958962527 3:100523652-100523674 GGAGGAGGAAGAAGAGAAGGAGG - Intronic
959152323 3:102622065-102622087 TCAGGAGAGAGAAAAGTAGGGGG + Intergenic
959435240 3:106306955-106306977 TCTGGGGAAAGAAAAGTAGGAGG - Intergenic
960509490 3:118531232-118531254 ACAGGCTGCAGAAAAGAAGCTGG - Intergenic
961076794 3:123990305-123990327 GGAGGAGGAAGAAGAGAAGGTGG + Intronic
962256502 3:133873402-133873424 TCTGGGGGAAAAAAAGCAGGAGG - Intronic
962989127 3:140562763-140562785 TCAGAAGGCAGAAAAGGAGGAGG - Intronic
963775269 3:149432872-149432894 TGAGGAGGAAGAAACAAAGGAGG + Intergenic
963863754 3:150337806-150337828 TTAGACTGAAGAAAAAAAGGAGG + Intergenic
964157021 3:153598706-153598728 TGAAGAGGAAGAAAAGAAGCTGG - Intergenic
965376140 3:167926660-167926682 TGAGGCAGAAGAAGAGATGGAGG - Intergenic
966266227 3:178047732-178047754 AAAGGAGGAAGGAAAGAAGGAGG + Intergenic
966741806 3:183241240-183241262 TAAGGGGGAATAGAAGAAGGAGG + Intronic
966947721 3:184788982-184789004 TAATGCAGAAGAAATGAAGGCGG + Intergenic
967240138 3:187430781-187430803 TCAGGCTGAAGACCAGTAGGAGG + Intergenic
967862688 3:194163924-194163946 TCAGGAGGAGGAAAGGGAGGAGG - Intergenic
967937074 3:194737662-194737684 GGAGGAGGAAGACAAGAAGGAGG - Intergenic
968317640 3:197737466-197737488 CCAGGAGAAAGAAGAGAAGGTGG + Intronic
968967398 4:3776075-3776097 TCTGACGGAAGAGAAGACGGAGG - Intergenic
969198558 4:5582865-5582887 GCAGGAGGAAGAGAAGTAGGGGG - Intronic
970386544 4:15562555-15562577 TAAGGTGGAAGAAGAGGAGGAGG - Intronic
970717128 4:18939435-18939457 TTAAGTTGAAGAAAAGAAGGAGG - Intergenic
971571776 4:28221692-28221714 TCATGGGGTAGAAAAGAATGTGG - Intergenic
972596969 4:40538168-40538190 TCAGGCAGAAGGAAAGAAAAGGG + Intronic
972693169 4:41419634-41419656 GAAGGAGGAAGAAAGGAAGGAGG - Intronic
974609687 4:64200273-64200295 ACAGGCTGCAGAAAAGAAGCTGG + Intergenic
975083367 4:70307294-70307316 TCAGACAGAAGAGAAGATGGGGG + Intergenic
975384335 4:73737945-73737967 TTAGGCGGAAAAAAAAAAGCAGG - Intergenic
975388557 4:73788282-73788304 TGAGGAGGATGAGAAGAAGGAGG + Intergenic
975441752 4:74419299-74419321 TAAAGAGAAAGAAAAGAAGGTGG + Intergenic
975861402 4:78680899-78680921 TCAGGAGGAAGAAAGGAAGAGGG + Intergenic
978604612 4:110465882-110465904 TTAGGTGGAAGAAAAGAGGAAGG - Intronic
978735915 4:112084053-112084075 TCAGGAGGAAGAAAAAAATGAGG - Intergenic
979514057 4:121586740-121586762 TCAGGCATAAGAAAAGAACATGG + Intergenic
979663245 4:123282802-123282824 GCAGGGGGGAGAAAAGAAGAAGG + Intronic
980182184 4:129414601-129414623 TCAGGGAGAAGAACAAAAGGTGG - Intergenic
980190675 4:129520483-129520505 GAAGGAGGAAGAAGAGAAGGAGG + Intergenic
981329688 4:143494510-143494532 TCAGGCATAAAAAAAGAATGAGG + Intergenic
982138496 4:152295299-152295321 TCAGGGGCAAGAAAAGAAAATGG + Intergenic
982235668 4:153249257-153249279 TCAGGCGGAAGAAAAGAAGGCGG - Intronic
982448398 4:155522290-155522312 ACAGGAGGAAGAAAAAAAGCTGG - Intergenic
982716468 4:158814072-158814094 GGAGGAGGAAGAAAAGGAGGAGG - Intronic
982860379 4:160441156-160441178 ACTGAGGGAAGAAAAGAAGGAGG - Intergenic
983136969 4:164096414-164096436 AAAGGAGGAAGAAAGGAAGGAGG + Intronic
985945789 5:3181857-3181879 GGAGGCGGAAGAAAACAGGGAGG + Intergenic
985993810 5:3585060-3585082 ACAGGAGGAGGAAAAGAGGGAGG + Intergenic
985993826 5:3585114-3585136 ACAGGAGGAAGGAAAGAGGGAGG + Intergenic
986015206 5:3751579-3751601 GCAGGAGGAAGAAAAAAAGAAGG + Intergenic
986048033 5:4059829-4059851 GCAGGAGGAAGAAGAGGAGGAGG - Intergenic
986660283 5:10053201-10053223 GCAGGAGGAAGAAATGGAGGGGG + Intergenic
987215395 5:15731550-15731572 TCAAGGGGAAGAAAAGAAAAAGG + Intronic
987447256 5:18035071-18035093 GCAGCAGGAAGAAAAGGAGGGGG - Intergenic
987551400 5:19386637-19386659 GCAAGAGGAAGAAAAGGAGGAGG + Intergenic
988617243 5:32786356-32786378 TCAGGCAGAAAAAAAAAAAGTGG - Exonic
988658775 5:33241457-33241479 TCAGGGTGAAGAAAATAAGAGGG + Intergenic
989007066 5:36826829-36826851 AGAGGGGGAAGGAAAGAAGGAGG + Intergenic
989475791 5:41870843-41870865 CCAGGCGGGAGAAGAGAAGGGGG - Intergenic
989754786 5:44939580-44939602 GCAGGCAGAAGAAGGGAAGGTGG + Intergenic
990031077 5:51260195-51260217 TCAGGAGGAAGATGAGAAGAAGG + Intergenic
990499894 5:56385693-56385715 GCAGGAGGAAGAAGAGGAGGAGG - Intergenic
990642094 5:57798228-57798250 GGAGGAGGAATAAAAGAAGGAGG + Intergenic
991249151 5:64540793-64540815 ACAGGCAGAAGAAAGGAGGGAGG + Intronic
991651552 5:68860377-68860399 GGAGGAGGAAGAGAAGAAGGAGG + Intergenic
991975168 5:72177970-72177992 TTAGAAGGAAGAAGAGAAGGAGG - Intronic
992142103 5:73808840-73808862 GCAGGAGGAGGAGAAGAAGGAGG - Intronic
992349732 5:75916452-75916474 GGAGGAGGAAGAAGAGAAGGAGG - Intergenic
992362032 5:76048839-76048861 TTAGGTGAAAGAAAGGAAGGGGG + Intergenic
992616888 5:78553681-78553703 TCCTGGGGAAGGAAAGAAGGTGG - Intronic
993283552 5:85959924-85959946 GCAGGCGGAGGGAAGGAAGGAGG - Intergenic
993505115 5:88699758-88699780 GCAGAAGGAAGAAAAAAAGGAGG - Intergenic
994535681 5:101026521-101026543 TAAGGCAGAAAAAGAGAAGGAGG - Intergenic
994743927 5:103655484-103655506 TGTAGCGGAAGAAAAGAATGAGG + Intergenic
995092902 5:108200352-108200374 TGAAGCAAAAGAAAAGAAGGAGG + Intronic
996360374 5:122638690-122638712 TCAGGGAGAAAAAAAAAAGGGGG - Intergenic
996987795 5:129588228-129588250 TTAGGAGGAAGAAGAGAGGGAGG + Intronic
996999795 5:129746105-129746127 TAAGGGGGGAGAAAAGAAGGGGG + Intergenic
997010101 5:129866652-129866674 TCAAGCTGGAGTAAAGAAGGGGG + Intergenic
997254985 5:132421646-132421668 TCAGATGAGAGAAAAGAAGGTGG + Intronic
997997514 5:138598421-138598443 GCAGGGGGTAGAAAGGAAGGAGG - Intergenic
999126336 5:149248908-149248930 ACAGGAGTAAGAAAAGGAGGAGG - Intronic
999299336 5:150481563-150481585 ACAGGAGGAAGAGAAGAAGCAGG + Intergenic
1000210437 5:159102457-159102479 TCAGGCAGATAAAGAGAAGGAGG - Intergenic
1001162747 5:169335914-169335936 TCAGTTGGAAGAAAGGAAGTGGG - Intergenic
1001813234 5:174646555-174646577 GCAGGCTGAAGAAGAGCAGGAGG + Intergenic
1002482203 5:179510022-179510044 GAAGGAGGAAGAGAAGAAGGAGG - Intergenic
1002870379 6:1161826-1161848 ACAGGAGGAAGAACAGAGGGTGG + Intergenic
1004115258 6:12760539-12760561 ACAGGGAGAAGAAAAGAGGGAGG + Intronic
1004743175 6:18483242-18483264 TCTGTTGGAAGAAGAGAAGGAGG + Intergenic
1004930588 6:20459310-20459332 TCAGTGGGAAGAACAGCAGGAGG + Intronic
1006342774 6:33455727-33455749 TCAGGTGGAAGAAGAAGAGGAGG + Exonic
1007107687 6:39294902-39294924 CCAAGAGGAAGAAAAAAAGGAGG + Intergenic
1007184870 6:39961181-39961203 TTAGAAGGGAGAAAAGAAGGGGG + Intergenic
1007459664 6:42009007-42009029 TCTGGCTTAAGAGAAGAAGGCGG - Intronic
1008041640 6:46807650-46807672 GGAGGAGGAAGAGAAGAAGGAGG + Intronic
1010745686 6:79558911-79558933 GCAGGAGGAGGAGAAGAAGGAGG + Intergenic
1012289673 6:97437220-97437242 TCAGGGGGAAGAAAATAACTTGG + Intergenic
1012574090 6:100769220-100769242 ACAGGGGGAAGAAAAGCATGGGG + Intronic
1015279609 6:131419072-131419094 GCAGGAGGAAGAAAAGAAGAGGG + Intergenic
1016441188 6:144085099-144085121 TCAAGCAGAGGAAAGGAAGGGGG + Intergenic
1016881602 6:148917181-148917203 TGAGGGGGAAGAAAGGAGGGTGG - Intronic
1016907557 6:149166842-149166864 GGAGGGGGAAGAAAGGAAGGAGG + Intergenic
1017440470 6:154460117-154460139 ACAGGCGAAAGAACAGAAGTTGG + Intronic
1018216545 6:161533748-161533770 ACAGGCGGAAGAAAGGAGAGAGG - Intronic
1019173330 6:170147052-170147074 TCCCGGGGAAGAAAAGGAGGCGG + Intergenic
1021092969 7:16504496-16504518 TGAGGGGGAAAAAGAGAAGGTGG + Intronic
1021431734 7:20567533-20567555 CCAGGTGGAATAAAAGAAGTGGG + Intergenic
1022045319 7:26617967-26617989 CAAGGGGAAAGAAAAGAAGGAGG + Intergenic
1022548220 7:31209095-31209117 TCTGGCAGAAGAGAATAAGGTGG + Intergenic
1022607613 7:31831715-31831737 GCAGACGGAAGAGTAGAAGGAGG + Intronic
1022998312 7:35781805-35781827 ACAGGAAGAAGAAAAGAAAGGGG - Intergenic
1023530821 7:41151866-41151888 TCATGCTGAAGAGAAGAAGGGGG - Intergenic
1023554935 7:41411740-41411762 TCAGCCTTAAGAAAAGAAGAAGG - Intergenic
1024109489 7:46130875-46130897 TCAGGCAGAAGAAAGGAGGGTGG - Intergenic
1024171342 7:46791075-46791097 TAAGGGGGAAGAAGGGAAGGGGG + Intergenic
1024525519 7:50345654-50345676 TCTGGTGTAAGAAAAGATGGAGG + Intronic
1024846618 7:53651712-53651734 TCAAGTGGCAGAAAAGAATGAGG - Intergenic
1025107995 7:56188916-56188938 AGAGGAGGAAGAAAAGGAGGAGG - Intergenic
1026310251 7:69177147-69177169 AGAGGAGGAAGAAAAGGAGGAGG + Intergenic
1026468654 7:70675926-70675948 CCAGGCTGAAGGAAAGAAGATGG + Intronic
1027656231 7:80934044-80934066 TCAGGAGGGAAAAAAAAAGGGGG - Intergenic
1028727808 7:94109205-94109227 GAAGGAGGAAGAAGAGAAGGAGG + Intergenic
1028759179 7:94475968-94475990 TGAGAAGAAAGAAAAGAAGGAGG - Intergenic
1030953366 7:115820554-115820576 TCAGAAGAAAGAAAGGAAGGAGG + Intergenic
1031685736 7:124730596-124730618 ACAGGCGGGAGGGAAGAAGGAGG - Intergenic
1031687946 7:124755371-124755393 TTAGGCAAAAGAAGAGAAGGTGG - Intronic
1031918289 7:127583252-127583274 TCAGGTAGAAGAACAGAGGGTGG - Exonic
1031992291 7:128206347-128206369 CCAGGCTGCAGCAAAGAAGGTGG + Intergenic
1032014761 7:128371658-128371680 TAAGGAGGAGAAAAAGAAGGAGG + Intergenic
1032350401 7:131157764-131157786 TAAGGCAGAAGGAAAGAAAGAGG + Intronic
1032523247 7:132561817-132561839 GGAGGCGGAGGAGAAGAAGGAGG - Intronic
1032523796 7:132564159-132564181 GCAGGAGGAAGAGGAGAAGGAGG - Intronic
1033609973 7:142955822-142955844 TTAGGAGGAAGATAAGAAAGTGG - Intronic
1033785228 7:144722071-144722093 TCAAGCAGAAGGAAAAAAGGAGG - Intronic
1034075849 7:148230503-148230525 TCAGGAGAAAGAACAGCAGGAGG + Intronic
1034252927 7:149706662-149706684 TTAGGGGGAAGAAGAGGAGGGGG - Intergenic
1034568561 7:151935652-151935674 CCAGGTGGAAGACAAGAAGAGGG + Intergenic
1034923059 7:155099490-155099512 GGAGGAGGAAGAAAAGGAGGAGG + Intergenic
1034951363 7:155298644-155298666 CCAGGCGGAGGAAAAGATGGTGG - Exonic
1035058170 7:156050662-156050684 TGAGGTGGGACAAAAGAAGGTGG + Intergenic
1035856358 8:2980418-2980440 GGAGGAGGAAGAAAAGGAGGAGG - Intronic
1036500877 8:9312827-9312849 TTAGGAAGAAGAAAAGAGGGAGG + Intergenic
1037300459 8:17446038-17446060 GAAGGAGGAAGAAGAGAAGGAGG - Intergenic
1037522888 8:19697397-19697419 TCAGGCAGAAGAACAGTACGGGG + Intronic
1037598438 8:20373763-20373785 GGAGGAGGAAGAAAAGGAGGAGG + Intergenic
1037612916 8:20491441-20491463 TGAGGAGGAAGAGAAGAAGGAGG + Intergenic
1037873275 8:22520562-22520584 TCAGGCAGAAGAAAAGAACTGGG - Intronic
1038492791 8:27982357-27982379 CAAGGCGGGAGAAAGGAAGGTGG + Intronic
1039435983 8:37559559-37559581 GGAGGAGGAGGAAAAGAAGGAGG + Intergenic
1039822330 8:41145203-41145225 TTAGGCTAAAGAAATGAAGGTGG - Intergenic
1039986295 8:42451158-42451180 AGAGGTGGAAGAAGAGAAGGAGG + Intronic
1040071914 8:43195590-43195612 GGAGGAGGAAGAAGAGAAGGAGG + Intronic
1040522903 8:48193209-48193231 GGAGGAGGAAGAGAAGAAGGAGG + Intergenic
1040947086 8:52894982-52895004 TGAGGCAGAAAAAAAGCAGGAGG + Intergenic
1041108855 8:54467146-54467168 GGACGCGGAGGAAAAGAAGGTGG - Intergenic
1041284294 8:56244452-56244474 GCAGGGGGAAGAACTGAAGGAGG + Intergenic
1041590901 8:59581863-59581885 GGAGGAGAAAGAAAAGAAGGGGG + Intergenic
1041746156 8:61211341-61211363 GGAGGGGGAAGAGAAGAAGGAGG - Intronic
1043266579 8:78273691-78273713 GAAGGAGGAAGAAAAGATGGAGG - Intergenic
1043823706 8:84899647-84899669 TGAGGAGGAACAACAGAAGGAGG + Intronic
1044037053 8:87319231-87319253 ACAGGAGGAAGCAAGGAAGGGGG + Intronic
1044041071 8:87368924-87368946 TCATGAGAAGGAAAAGAAGGAGG - Intronic
1045160858 8:99542448-99542470 CCAGGTAGAGGAAAAGAAGGTGG + Intronic
1045377215 8:101586037-101586059 TGAGGTGGAAGGAAAGAAGAGGG - Intronic
1045390137 8:101707120-101707142 TCTGGGGGAAAAAAAGGAGGGGG - Intronic
1046675591 8:117104552-117104574 TCAGAAAGAAGTAAAGAAGGAGG - Intronic
1047061859 8:121235797-121235819 TGAGAAGGAAGGAAAGAAGGTGG - Intergenic
1047283177 8:123463720-123463742 TAAGGGGGAAGAAAGGAAGCAGG + Intronic
1047655589 8:126973555-126973577 TCAGACTGAAGAAAAAAAGAGGG - Intergenic
1047852390 8:128871642-128871664 GAAGGAGAAAGAAAAGAAGGAGG + Intergenic
1048417445 8:134243173-134243195 GGAGGAGGAGGAAAAGAAGGAGG + Intergenic
1048583139 8:135747172-135747194 TCAGGTGGAAGAAATAAAGCAGG + Intergenic
1049011934 8:139893001-139893023 TCAGGAGGATGAAAAGATAGAGG + Intronic
1050347929 9:4711208-4711230 TCAGGCAGCAGAAAGGAAGGTGG + Exonic
1050453227 9:5806306-5806328 TCATGAGGAATACAAGAAGGGGG - Intronic
1050948747 9:11561180-11561202 TCAGGAGGAAGAAAGGCAGAAGG - Intergenic
1051062448 9:13060026-13060048 TCAGGCCCAAGAAACTAAGGAGG + Intergenic
1053071605 9:35105307-35105329 TCCGGCGGGAAAAAAGCAGGCGG + Exonic
1055279073 9:74653531-74653553 TCAGGAGGAAAAAAAGAGGGAGG + Intronic
1055527775 9:77152706-77152728 GGAGGAGGAAGAAAAGAAGAAGG - Intergenic
1057155690 9:92837155-92837177 TGAGGAGGAGGACAAGAAGGCGG - Intergenic
1058170957 9:101680683-101680705 CCTGGTGGAAGAACAGAAGGGGG + Intronic
1059365827 9:113785815-113785837 AGAGGAGGAAGAAAAGGAGGAGG + Intergenic
1060157116 9:121327535-121327557 CCAAGCTGAAGGAAAGAAGGGGG - Intronic
1061126425 9:128679375-128679397 TCTGGTGGAAGAAAAGGTGGAGG - Intergenic
1061264397 9:129496992-129497014 CCAGGAAGAAGAAAGGAAGGAGG + Intergenic
1061613640 9:131764796-131764818 TCAGATAGAAGAAGAGAAGGAGG - Intergenic
1062163900 9:135096096-135096118 GGAGGAGGAAGAAGAGAAGGAGG - Intronic
1203615731 Un_KI270749v1:61970-61992 AAAGACGAAAGAAAAGAAGGAGG + Intergenic
1185591519 X:1280616-1280638 GGAGGAGGAAGAAGAGAAGGAGG - Intronic
1185591697 X:1281426-1281448 GCAGGAGGAGGAGAAGAAGGAGG - Intronic
1185692938 X:2171454-2171476 ACAGGCGGAATGCAAGAAGGTGG - Intergenic
1186077577 X:5897883-5897905 AGAGGAGGAAGGAAAGAAGGAGG - Intronic
1186206329 X:7204661-7204683 TGAGGAGGAAAAAAGGAAGGAGG - Intergenic
1186247144 X:7626355-7626377 TCAGGAGGAGGAAAGGAAGGAGG - Intergenic
1186264648 X:7818876-7818898 GGAGGAGGAAGAAGAGAAGGTGG + Intergenic
1186404962 X:9293748-9293770 TCAGTAGAAAGAAAAAAAGGAGG + Intergenic
1187424578 X:19165617-19165639 TCTGGGGGAAGAAAAGACTGTGG - Intergenic
1187481049 X:19656033-19656055 TCTAGCTGAAGAAAAGCAGGAGG + Intronic
1188316291 X:28677952-28677974 GAAGGAGGAGGAAAAGAAGGAGG - Intronic
1189209193 X:39268833-39268855 TCAGACAGAAGATCAGAAGGTGG + Intergenic
1189723967 X:43950026-43950048 TCTGGGGAAAGAAAAGGAGGTGG + Exonic
1190153976 X:47972914-47972936 GCAGGAGGAAGAAAGGAAGAAGG + Intronic
1190886470 X:54534800-54534822 TCAGAGGGGAGAAGAGAAGGGGG - Intronic
1191033665 X:56003042-56003064 GAAGGAGGAAGAAAGGAAGGAGG - Intergenic
1191184828 X:57598710-57598732 TGGGGGGGAAGAAAAGAGGGAGG + Intergenic
1191607637 X:63079617-63079639 TCAGGATTAAGGAAAGAAGGGGG + Intergenic
1191883459 X:65864768-65864790 TTAGGGGCAAGCAAAGAAGGAGG + Intergenic
1192331066 X:70175597-70175619 CCAAGGGGAAGAAAAGAAAGAGG + Intergenic
1195280852 X:103331002-103331024 TCTGGGGGAAGAAAAGGAGCAGG + Exonic
1195370101 X:104165393-104165415 GCAGGAGGAAGAAGAGAAAGAGG - Intergenic
1195759900 X:108235093-108235115 GCAGGAGGAAGCAAAGCAGGTGG + Intronic
1196181098 X:112690472-112690494 TGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1196181100 X:112690487-112690509 GGAGGAGGAAGAGAAGAAGGAGG + Intergenic
1196663116 X:118289290-118289312 TCAGGTGACAGAAAGGAAGGTGG + Intergenic
1196748524 X:119093757-119093779 TCAGGTGGAACCAAAGGAGGAGG - Exonic
1196852319 X:119949157-119949179 GAAGGAGGAGGAAAAGAAGGGGG - Intergenic
1196979535 X:121196224-121196246 TTAGAAGGAAGAAAAGAAGAGGG - Intergenic
1197856800 X:130921761-130921783 TAAGGAGGAAGAGAAAAAGGAGG - Intergenic
1198260630 X:134961727-134961749 TGAGGAGGAAGAAGAGGAGGAGG - Intergenic
1199250913 X:145660420-145660442 GCAGGAGGAAGAGAAAAAGGCGG - Intergenic
1199665845 X:150095798-150095820 AGAGGTGGAAGAAAACAAGGAGG + Intergenic
1199790378 X:151149123-151149145 GGAGGCTGAAGAAAAGTAGGTGG - Intergenic
1200812340 Y:7499153-7499175 AGAAGAGGAAGAAAAGAAGGAGG - Intergenic
1201361440 Y:13154683-13154705 TAAGGCTGAAGAAAATAAAGTGG - Intergenic
1202106160 Y:21368862-21368884 AAAGGAGGAAGAAAAGATGGAGG + Intergenic