ID: 982235669

View in Genome Browser
Species Human (GRCh38)
Location 4:153249260-153249282
Sequence CGCTCAGGCGGAAGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235669_982235674 -2 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235674 4:153249281-153249303 CGCAGCTCGGCTCCCGCCTCGGG No data
982235669_982235675 -1 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235675 4:153249282-153249304 GCAGCTCGGCTCCCGCCTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 123
982235669_982235682 17 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235682 4:153249300-153249322 CGGGGCGGGGCCTGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 150
982235669_982235677 3 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235677 4:153249286-153249308 CTCGGCTCCCGCCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 28
4: 172
982235669_982235676 2 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235676 4:153249285-153249307 GCTCGGCTCCCGCCTCGGGGCGG 0: 1
1: 0
2: 2
3: 20
4: 147
982235669_982235673 -3 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235673 4:153249280-153249302 GCGCAGCTCGGCTCCCGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 282
982235669_982235684 25 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235669_982235678 4 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235678 4:153249287-153249309 TCGGCTCCCGCCTCGGGGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 100
982235669_982235683 24 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235669 Original CRISPR CGCTCAGGCGGAAGAAAAGA AGG (reversed) Intronic
903954881 1:27018434-27018456 AGCTCAGATGGAAGTAAAGAGGG - Intergenic
908760979 1:67511672-67511694 GACTGAGGAGGAAGAAAAGAAGG + Intergenic
913548817 1:119896564-119896586 GGCGCAGGTGGAAGAAAGGAGGG + Intergenic
915167033 1:153953688-153953710 AGCTAAGGTGGAAGTAAAGATGG + Intronic
922677070 1:227559755-227559777 CGCTAAGGCGGACGACCAGAGGG + Intergenic
923816844 1:237389662-237389684 CCCTGAGGCAGAAAAAAAGATGG - Intronic
1063140033 10:3247845-3247867 CACTGAGGAAGAAGAAAAGAAGG + Intergenic
1065498792 10:26357488-26357510 GGCTCAGGGTGAAGAAGAGAGGG + Intergenic
1065526254 10:26624209-26624231 GGCTCAGGCGGAAGATAAAGAGG + Intergenic
1065531802 10:26677720-26677742 GGCTCAGGCGGAAGATAAAGAGG + Intergenic
1068450960 10:57187484-57187506 CACTCATGAGGAAGAAAAGTGGG - Intergenic
1070932238 10:80269484-80269506 AGCTCAGGAGGCAGAACAGATGG + Intergenic
1075546020 10:123355327-123355349 CACTCAGGGAGAAGAGAAGATGG - Intergenic
1080938592 11:36888142-36888164 GGCTCAGGGGTAGGAAAAGAGGG + Intergenic
1081296634 11:41398175-41398197 CCCTGAGGCAGTAGAAAAGAGGG - Intronic
1081505930 11:43717015-43717037 AGCTCAGTCTGAAGAAAAGCTGG + Intronic
1084125338 11:67095489-67095511 CGCTCAGGGTGAAGACAAGCAGG + Intergenic
1085294104 11:75421055-75421077 CGCTCAGGACAAAGCAAAGAAGG - Intronic
1088412168 11:109546385-109546407 AGGGCAGGAGGAAGAAAAGATGG + Intergenic
1088847725 11:113682029-113682051 CACTCAGGAGGAGGAAGAGAAGG - Intergenic
1090413418 11:126524496-126524518 CGATCCGGAGGGAGAAAAGAAGG - Intronic
1090875343 11:130784108-130784130 CTCAGAGGAGGAAGAAAAGAGGG - Intergenic
1091601341 12:1919296-1919318 CCCTCAGACGGAAGAGAAGTTGG - Intergenic
1091854725 12:3730294-3730316 CGCTCAGGCTGAACGCAAGAGGG + Intronic
1094312614 12:29101301-29101323 AGCTCAAGCGGAAGGAAGGAGGG - Intergenic
1098980760 12:76953169-76953191 CCCTCAGGCTGTAGAACAGATGG - Intergenic
1103500801 12:121400285-121400307 CGCTAAGGCGGAAAGAAAGGAGG - Intronic
1104102475 12:125626179-125626201 CCTTCAGGCAGAAAAAAAGAAGG - Intronic
1105746752 13:23384179-23384201 TGCTCAGGCAGAAGAGCAGAAGG + Intronic
1108303645 13:49107884-49107906 AGCTCAGGTGTAAGAGAAGACGG + Intronic
1115510967 14:34137543-34137565 TGCTGATGTGGAAGAAAAGAAGG + Intronic
1118080721 14:62356990-62357012 CTCTCAGACAGAAGAAAAAAGGG - Intergenic
1118586822 14:67360843-67360865 TGTTGGGGCGGAAGAAAAGATGG - Intronic
1121140794 14:91539756-91539778 TGCTCATGTGGTAGAAAAGAAGG - Intergenic
1124665605 15:31589055-31589077 TGCTTAGGCAGAAGGAAAGATGG + Intronic
1126188390 15:45853396-45853418 AGCCCAGGAGGAAGTAAAGAAGG - Intergenic
1130775911 15:86982597-86982619 GGCTCAGGAGGAAGAAGAGGAGG - Intronic
1132337678 15:101058887-101058909 CGCACAGTCGGTAGTAAAGACGG + Intronic
1132354343 15:101160022-101160044 AGCTTAGGTGGAAAAAAAGAGGG + Intergenic
1135290004 16:21228187-21228209 TGCTCAGGGAGAGGAAAAGAAGG - Intergenic
1135687681 16:24511297-24511319 TGCTCAGGAGGAAGAAGAAATGG - Intergenic
1139661265 16:68422487-68422509 TGCTCAGAGGGAGGAAAAGAAGG + Intronic
1141607793 16:85165044-85165066 CACTCAAGAGGAATAAAAGATGG + Intergenic
1142728158 17:1831430-1831452 AGCTCAGGCAAAAAAAAAGACGG - Intronic
1145819305 17:27819135-27819157 GGGTCAGGAGGAAGAAATGAAGG - Intronic
1146158658 17:30546960-30546982 TGCTTAGGCAGAAGAAATGATGG - Intergenic
1146922330 17:36722188-36722210 CTCTTAGTTGGAAGAAAAGAGGG - Intergenic
1146949101 17:36893407-36893429 CGTTCAGGCCAAAGAAACGATGG - Intergenic
1146949836 17:36898286-36898308 CGTTCAGGCCAAAGAAACGATGG + Intergenic
1152497098 17:80680971-80680993 CACACAGGCGGAAGAGGAGAGGG + Intronic
1152522213 17:80863095-80863117 GGCTCGGGCGGAAGAAAAGACGG + Intronic
1157763420 18:50281309-50281331 CGCTCAGGCGGAGGATGGGAAGG - Intronic
1168099056 19:54131324-54131346 CCCACAGGCGGCAGAGAAGAAGG + Exonic
925387484 2:3472205-3472227 CGCTGAGGTGGAAGAAGGGAAGG + Intronic
926024794 2:9532000-9532022 TACTCAGGAGGCAGAAAAGAGGG + Intronic
931517195 2:63056865-63056887 CGCTGGGGCGGAAGAAACGCCGG - Exonic
938414560 2:131093456-131093478 CGCTCAGGCGGAAGTGAGGTCGG - Intronic
938583957 2:132670856-132670878 CGCGCAGGCGGGAGAAGGGAGGG - Intronic
942877548 2:180819480-180819502 CACTCAGGCTAAAGGAAAGAGGG + Intergenic
944010826 2:194973105-194973127 CACTCAAGAGGAAGAAAGGAGGG - Intergenic
945092129 2:206185482-206185504 CGAGCAAGAGGAAGAAAAGAAGG + Intronic
946921476 2:224585372-224585394 CGCTCAGGCGGAGGAGGAGAAGG - Intronic
947309361 2:228783489-228783511 AGCTCAGTGGTAAGAAAAGATGG + Intergenic
948220317 2:236264373-236264395 CGCTTTAGAGGAAGAAAAGAAGG - Intronic
1170080466 20:12469254-12469276 AGCTCAGGGGGAAAAAAAAATGG - Intergenic
1171989883 20:31687859-31687881 CTCTCAGGAGGAAGAACATATGG - Intronic
1176551631 21:8225330-8225352 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1176570540 21:8408329-8408351 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1176578449 21:8452496-8452518 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1178786486 21:35658473-35658495 CGTTCAGTCAGAAAAAAAGATGG + Intronic
1179294276 21:40046848-40046870 AGCTCAAGCAGAAGAAATGAGGG - Intronic
1180112920 21:45672963-45672985 AGCTCAGGGGGAAGAGAAAAAGG - Intronic
1180676154 22:17587780-17587802 CGCTCACGGGGCACAAAAGAAGG + Intronic
1181603609 22:23966871-23966893 AGCTCTGGCGGAAGAAAAGCTGG - Intergenic
1181604904 22:23974436-23974458 AGCTCTGGCGGAAGAAAAGCTGG + Exonic
1203256653 22_KI270733v1_random:142250-142272 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
949450760 3:4182444-4182466 GGCAAAGGGGGAAGAAAAGAGGG - Intronic
949536809 3:5002630-5002652 CGCTCAGGATGTAGAAAACAGGG - Intergenic
950339983 3:12234586-12234608 GGCTCAGGGAGCAGAAAAGAGGG - Intergenic
950979533 3:17288151-17288173 TGCTAAGGGGGAAAAAAAGAGGG - Intronic
961494818 3:127284012-127284034 AGACCAGGTGGAAGAAAAGAAGG + Intergenic
962075204 3:132074288-132074310 GGCTCAGGGTGGAGAAAAGATGG + Intronic
963305994 3:143653675-143653697 AGCTCAGGCAGAAGAGCAGAGGG + Intronic
965441617 3:168721999-168722021 CACTCAGGCAGACGAAAAGCAGG + Intergenic
967531524 3:190553682-190553704 CGCTCAGGGGTCAGAAAAGACGG - Intronic
969994336 4:11296062-11296084 AGGTCAGGGGGAAGAAAAGCGGG - Intergenic
970321710 4:14881351-14881373 CAGTCAGCCAGAAGAAAAGATGG + Intergenic
972238730 4:37165154-37165176 CACTCAGGCAGAAGCAATGAAGG - Intergenic
976830913 4:89312916-89312938 AGCACAGGAGGGAGAAAAGAGGG - Intergenic
981034306 4:140153533-140153555 AGCTCAAGGGGAAGAAAAGGGGG + Exonic
982235669 4:153249260-153249282 CGCTCAGGCGGAAGAAAAGAAGG - Intronic
983058494 4:163127743-163127765 AGCTCATGGGGAAGAAAAGTGGG + Intronic
985516999 5:352105-352127 CAATCATGCGAAAGAAAAGATGG - Intronic
997634860 5:135397941-135397963 CACAAAGGTGGAAGAAAAGAGGG + Intronic
998869155 5:146535300-146535322 CTCCCAGGTGGAAGAAAACATGG - Intergenic
1003947094 6:11085911-11085933 GGCTCAGGAGGAGGAAAAGCAGG + Intergenic
1005881477 6:30065363-30065385 GGCTCAGGAGGAGGAAAAGGAGG - Intergenic
1007721934 6:43890400-43890422 GGCTCAGAGGGAAGAAATGATGG + Intergenic
1012898144 6:104975512-104975534 CTCTCAGGTGGCAGAACAGAAGG - Intronic
1014148720 6:118028571-118028593 TTCACAGGTGGAAGAAAAGAAGG + Intronic
1014357385 6:120430027-120430049 CTCTAAGGCGGAAAAAAAAATGG - Intergenic
1016881603 6:148917184-148917206 GGCTGAGGGGGAAGAAAGGAGGG - Intronic
1017170695 6:151452016-151452038 CTCTCCGCCGGAAGAGAAGAAGG + Exonic
1022498885 7:30870374-30870396 AGCTCAGGCAGAAGAATTGATGG - Intronic
1026651927 7:72223180-72223202 CGGTCAGGCAGAGGAGAAGAGGG + Intronic
1026769767 7:73188194-73188216 GGCTCAGCAGGAAGAAGAGAGGG - Intergenic
1027010635 7:74741576-74741598 GGCTCAGCAGGAAGAAGAGAGGG - Intronic
1027077407 7:75204464-75204486 GGCTCAGCAGGAAGAAGAGAGGG + Intergenic
1028894083 7:96021371-96021393 TGCTCAGGAAGAAGGAAAGAGGG + Intronic
1029155425 7:98514204-98514226 GGCTCTGGTGGAAGGAAAGAGGG - Intergenic
1031050528 7:116940343-116940365 GGCTGAGGAGGAGGAAAAGAGGG - Intergenic
1034951365 7:155298647-155298669 CCACCAGGCGGAGGAAAAGATGG - Exonic
1053516529 9:38735075-38735097 CACACAGAAGGAAGAAAAGAAGG - Intergenic
1055279072 9:74653528-74653550 TTCTCAGGAGGAAAAAAAGAGGG + Intronic
1061627180 9:131847650-131847672 CCCACAGCAGGAAGAAAAGAAGG + Intergenic
1203472810 Un_GL000220v1:123954-123976 GGCTGAGGCGGGAGGAAAGAAGG - Intergenic
1186247145 X:7626358-7626380 CTCTCAGGAGGAGGAAAGGAAGG - Intergenic
1187822143 X:23298996-23299018 TGCTCAGGAGGAAAAAAAAATGG - Intergenic
1188968115 X:36579971-36579993 CCTTCAGGAGGAAAAAAAGAGGG + Intergenic
1194729281 X:97435104-97435126 CGCTCTGGTGGAATAAAAAAGGG + Intronic
1197248053 X:124186898-124186920 TCCTCAGGCAGAGGAAAAGAAGG + Intronic
1199031599 X:143006550-143006572 CGCACAGGCAAAAAAAAAGATGG + Intergenic