ID: 982235671

View in Genome Browser
Species Human (GRCh38)
Location 4:153249272-153249294
Sequence GGAGCCGAGCTGCGCTCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235671_982235676 -10 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235676 4:153249285-153249307 GCTCGGCTCCCGCCTCGGGGCGG 0: 1
1: 0
2: 2
3: 20
4: 147
982235671_982235678 -8 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235678 4:153249287-153249309 TCGGCTCCCGCCTCGGGGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 100
982235671_982235686 19 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235686 4:153249314-153249336 TTGCTATGGAGCCCGGGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 138
982235671_982235677 -9 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235677 4:153249286-153249308 CTCGGCTCCCGCCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 28
4: 172
982235671_982235682 5 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235682 4:153249300-153249322 CGGGGCGGGGCCTGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 150
982235671_982235683 12 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235671_982235684 13 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235671 Original CRISPR GGAGCCGAGCTGCGCTCAGG CGG (reversed) Intronic
900466914 1:2830201-2830223 TGAGCCAAGCTGAGCTCTGGGGG + Intergenic
901163664 1:7199274-7199296 GGAAGCAAGCTGCGCTCAGCGGG + Intronic
901229873 1:7635718-7635740 GGTGGCGAGATGGGCTCAGGTGG - Intronic
905210943 1:36373898-36373920 GGAGCAGAGCAGGCCTCAGGGGG - Intronic
906285986 1:44588212-44588234 GGAGCCGGGCTGTTCTCAGCAGG + Intronic
915032625 1:152896706-152896728 GGAGGGGAGCTGCACCCAGGGGG - Intergenic
915128206 1:153680066-153680088 GGAACCGAGCTGTGCTAGGGTGG - Intronic
920400891 1:205675770-205675792 GGAGCTGGGCAGGGCTCAGGTGG - Intronic
923377631 1:233380259-233380281 GGAGCCAGGCTGAGCTCAGAAGG - Intronic
924599244 1:245473852-245473874 AGAGCAGAGCTGCACTGAGGAGG - Intronic
924738053 1:246777008-246777030 CGAGCTGAGCTGCTCTCAGCTGG - Intergenic
1062854401 10:772484-772506 GGAACCCATCTGCGCACAGGTGG - Intergenic
1062958194 10:1554008-1554030 GGAGCAGAGCTGAGCGCTGGGGG - Intronic
1069860896 10:71471204-71471226 AGAGCCGGGCTGCGCGCAGATGG - Intronic
1070754256 10:78981872-78981894 GGAGCAGGGCTGGGCTGAGGTGG - Intergenic
1071588094 10:86845277-86845299 GAAGCCCAGCTGCCCGCAGGGGG - Intronic
1072697048 10:97611596-97611618 GGAGCTGAGCCCCGCTGAGGAGG + Exonic
1075802175 10:125160439-125160461 GGAGCCATGCCGCGCTGAGGGGG - Intronic
1076869607 10:133186923-133186945 GGAGCCGGGCAGGGCTGAGGAGG - Intronic
1076898379 10:133325256-133325278 GAAGCCGTGGTGCGCCCAGGCGG - Intronic
1077319995 11:1936823-1936845 GGAGCCGAGGAGCCCTCATGGGG + Intronic
1080794123 11:35547578-35547600 GGAGCCGAGCAGTGGTCTGGGGG + Intergenic
1083278075 11:61608792-61608814 AGAGCAGAGCTGGGCTCTGGAGG - Intergenic
1083296023 11:61716091-61716113 GGAGGGGAGCTGTGCTGAGGAGG + Intronic
1084239003 11:67805956-67805978 GGCTGCGGGCTGCGCTCAGGAGG + Intergenic
1084823060 11:71707273-71707295 GGAGCCCAAGTCCGCTCAGGGGG + Intergenic
1084833429 11:71786884-71786906 GGCTGCGGGCTGCGCTCAGGAGG - Intergenic
1086420489 11:86632977-86632999 GGGGCCGTGCAGTGCTCAGGCGG - Intronic
1086993916 11:93335065-93335087 GCAGCAAAGCTGTGCTCAGGAGG - Intronic
1089785595 11:120904779-120904801 GGATCCAAGCTGGGCTCTGGAGG - Intronic
1090449179 11:126791149-126791171 GCAGCCAGGCAGCGCTCAGGAGG - Intronic
1096800931 12:54109985-54110007 GGAGTAGGGCTGCGCACAGGAGG - Intergenic
1096803410 12:54126402-54126424 GGACCCGAGCAGCGATCCGGAGG - Intergenic
1097929553 12:65169423-65169445 GGAGCCGCGCGCTGCTCAGGTGG + Intergenic
1098119143 12:67217362-67217384 GGAGCCAACCTGCACTCAAGTGG - Intergenic
1102466969 12:113135675-113135697 GGAGCCGTGCTCCGAGCAGGAGG + Intronic
1102952944 12:117042224-117042246 GGAGCCGAGCGTCGCTCACCAGG + Intronic
1103325541 12:120117359-120117381 GGAGCAGAGCTGCGAGGAGGTGG + Intronic
1104943958 12:132407379-132407401 GGAGCCGTCGTGCGCTCAGTCGG + Intergenic
1109799246 13:67354007-67354029 GAACCTGAGCTGGGCTCAGGGGG - Intergenic
1112402284 13:99086983-99087005 GGAGCCCGGCTGCGCTCGAGGGG + Intergenic
1118992466 14:70809142-70809164 GCAGCCGAGAAGCGCTCTGGAGG + Exonic
1119627881 14:76197476-76197498 GGAAAGGAGCTGGGCTCAGGAGG - Intronic
1119774668 14:77240788-77240810 GGGGCCCAGCTGCTCTCAAGGGG + Intronic
1122802364 14:104238074-104238096 GGTGCCGAGGTGGGCACAGGAGG + Intergenic
1123109486 14:105859090-105859112 CGAGCCGAGCTGAGCTTAGCTGG - Intergenic
1123109573 14:105859531-105859553 TGAGCCGAGCTGAGCTTAGCTGG - Intergenic
1125047970 15:35264634-35264656 GGAGCCCAGCAGCAGTCAGGTGG + Intronic
1125513962 15:40307751-40307773 GGAGCCAAGCTGGGCTCAAATGG + Exonic
1125739965 15:41955566-41955588 GGAGTAAAGCTGGGCTCAGGAGG + Intronic
1125741494 15:41967967-41967989 GGAGCCCAGCTGTGTTCAAGAGG - Intronic
1128784227 15:70383072-70383094 GGATCCGAGCTGCACTTAAGGGG - Intergenic
1130975394 15:88769623-88769645 GGAGCCGCGAGGCGCTCTGGAGG - Intergenic
1132383576 15:101383727-101383749 GGATGCAAGCTGCCCTCAGGTGG + Intronic
1132624157 16:882281-882303 GGAGGCGAGCCATGCTCAGGAGG - Intronic
1133350664 16:5098368-5098390 GGCTGCGGGCTGCGCTCAGGAGG + Intergenic
1139539027 16:67599969-67599991 GGAGCCTTGGTGTGCTCAGGGGG + Intronic
1141862818 16:86729542-86729564 GGAGCAGAGGTGCTCTCCGGTGG - Intergenic
1141894022 16:86947072-86947094 GGAGCCTAGCTGCTCACAGCAGG - Intergenic
1142119626 16:88379547-88379569 GGAGCAAAGCTGCCCCCAGGAGG + Intergenic
1142215696 16:88828786-88828808 GGAGCCGGGCGGCGCTGGGGTGG + Intronic
1142509208 17:384119-384141 GGAGCTGAGCTTTGCCCAGGAGG + Intronic
1142586892 17:979526-979548 GGCGCTGAGCTGCGCGCAGGGGG + Exonic
1142590165 17:1001125-1001147 GGATCCGGGCTGCTCTCTGGAGG + Exonic
1143972228 17:10803982-10804004 GGAGCCCAGCTGCACTCCCGGGG + Intergenic
1144548068 17:16215740-16215762 GGGGCCGAGCAGCGCCCAGCCGG + Intronic
1144816416 17:18038830-18038852 GGGGCCGAGCTGGGGTAAGGTGG - Intronic
1145265118 17:21376359-21376381 GTTGCCGAGCTGAGCTCCGGTGG + Exonic
1147429637 17:40363488-40363510 GGAGGCGGGCGGCGCTGAGGCGG - Exonic
1148582784 17:48755035-48755057 GGAGCCGGGATGCCCTCCGGCGG + Intergenic
1148764364 17:50028639-50028661 GGAGGGGAGCTGAGCCCAGGCGG - Intergenic
1149610305 17:57954724-57954746 GGAGCCGAGCGCCTTTCAGGGGG - Intronic
1152008086 17:77694987-77695009 GGGGCTAAGCTGCTCTCAGGTGG - Intergenic
1152081504 17:78190372-78190394 GGAGCTGATCTGCGCTGAGAGGG - Intronic
1152279583 17:79377575-79377597 GACGCAGAGCTGCACTCAGGCGG + Intronic
1160568010 18:79798727-79798749 GGACCCGGGCTGCGCTCGGCGGG - Intergenic
1160932085 19:1575604-1575626 GGAGCCTCGGTGCGCCCAGGGGG + Intronic
1161993827 19:7700352-7700374 GGTGCCGGGCTGCGCACAGTGGG + Intronic
1162731707 19:12722275-12722297 GGAACCGAGCAGAGCTTAGGGGG - Intronic
1165909025 19:39212517-39212539 GGAACCCAGAAGCGCTCAGGAGG + Intergenic
1166299632 19:41906545-41906567 GGGTCCGTGCTGGGCTCAGGGGG - Exonic
1167575091 19:50314202-50314224 GGGGCCGAGTTGAGCTCAGGTGG - Intronic
1168713362 19:58513930-58513952 AGAGAGGACCTGCGCTCAGGAGG + Exonic
925018313 2:548224-548246 GGAGGGGCGCTGTGCTCAGGAGG - Intergenic
926612279 2:14958421-14958443 GGAGCCAAGCTGCTCACAGAGGG + Intergenic
934951093 2:98576286-98576308 GGAGAGGAGGTGCACTCAGGTGG + Intronic
936276321 2:111100838-111100860 GGAGCCCAGCTGCAATAAGGAGG + Intronic
937979865 2:127608656-127608678 GGGGCCCAGCAGGGCTCAGGGGG - Intronic
938553204 2:132399647-132399669 GGATCCAGGCTGCCCTCAGGAGG + Intergenic
941481681 2:166023605-166023627 GGAGCAGATCTGGACTCAGGAGG + Intronic
946179010 2:217938833-217938855 GGAGCTGAGCGGCCCTCCGGAGG - Intronic
947435174 2:230067219-230067241 GGAGCGGAGCTGAGCTGAGCTGG + Intronic
948641313 2:239377616-239377638 GCAGCCGAGGTGCGGGCAGGAGG + Intronic
948708601 2:239811163-239811185 GGAGCTGAGCTGGGCTCAGAAGG + Intergenic
1169193563 20:3672019-3672041 GGAGAGGGGCTGCGCTCAGCGGG + Intronic
1172299972 20:33842527-33842549 GGAGCCGAGCAAGGCTGAGGGGG - Intronic
1172441700 20:34970744-34970766 AGAGCCGAGCTGAGCTGAGCTGG - Intergenic
1172999035 20:39092265-39092287 GGATCTGAGCTACACTCAGGTGG + Intergenic
1173528348 20:43749922-43749944 GGGGCCGTGCTGCCCTCTGGTGG - Intergenic
1173751412 20:45479784-45479806 GCACCTGAGCTGCTCTCAGGAGG - Intronic
1174093178 20:48066479-48066501 GGAGCAGGGCTGCTCTCAGCAGG + Intergenic
1178856276 21:36253045-36253067 GGAGCCGACAGGCGCTCAGGAGG - Intronic
1181438431 22:22923443-22923465 GGAGCTGAGCTGGGCACAGAGGG - Intergenic
1184259886 22:43308708-43308730 GGAGCCCAGCTGCACCCTGGGGG - Intronic
1184418399 22:44364995-44365017 GGAGCTGAGCTGAGCTGAGCTGG + Intergenic
1185190315 22:49432370-49432392 GGAGCCGAGGGGAGCACAGGAGG - Intronic
1185287801 22:50010355-50010377 GGATCCGAGCAGGCCTCAGGTGG + Intronic
952625019 3:35393105-35393127 TGAGCTGAGCTGAGCTCAGGAGG - Intergenic
954436738 3:50500294-50500316 GGAGCAGAGCTGGGCTAAGAGGG + Intronic
957054929 3:75435715-75435737 GGCTGCCAGCTGCGCTCAGGAGG + Intergenic
959000419 3:100957773-100957795 GGAGCTGAGCTGTGAGCAGGCGG - Intronic
961299908 3:125915959-125915981 GGCTGCGGGCTGCGCTCAGGAGG - Intergenic
961599907 3:128052504-128052526 GGAGCAGAGCTGAGCTGAAGCGG + Exonic
961888602 3:130112114-130112136 GGCTGCGGGCTGCGCTCAGGAGG + Intronic
969007887 4:4036369-4036391 GGAGCCCAGGTCCCCTCAGGGGG - Intergenic
969756259 4:9152633-9152655 CGGGCTGGGCTGCGCTCAGGAGG - Intergenic
977607370 4:98996055-98996077 GGAACCGCGCTGGGCTCACGCGG + Intronic
982235671 4:153249272-153249294 GGAGCCGAGCTGCGCTCAGGCGG - Intronic
983301653 4:165933729-165933751 GGAGCGGACCTGCTCTGAGGTGG - Intronic
985695612 5:1338434-1338456 AGAGACGAGGTGAGCTCAGGTGG + Intronic
985778254 5:1856743-1856765 GGAGCCGGGGTGGGCTCCGGAGG - Intergenic
989643185 5:43603134-43603156 GGAGCGGAGCTGCAGTCACGTGG + Intronic
993901175 5:93584975-93584997 GGAGCCGAGCTGCTCGCCGAGGG - Exonic
997230072 5:132235843-132235865 GGAGCAGAGCTTGGCTGAGGCGG + Intronic
997328726 5:133043767-133043789 AGAGCAGAGCTGGGCTGAGGAGG + Intergenic
998368155 5:141644370-141644392 GGAGCTGAGCTTCCCTGAGGGGG - Exonic
1002074569 5:176700482-176700504 GGAGTGGAGCTGCGCTGGGGTGG + Intergenic
1002538401 5:179890937-179890959 GGAGCCGAGCCACGCCAAGGTGG + Intronic
1002648453 5:180673991-180674013 GCAGCGGAGCCGCGGTCAGGCGG - Intergenic
1004193992 6:13487754-13487776 GGAGCCGGGCTGGGCTCCCGGGG - Intergenic
1006026156 6:31148478-31148500 GGAGCTGAGCCGTGCTCAGGAGG - Exonic
1007442323 6:41873145-41873167 GGAGCAGAGCTGGGATTAGGTGG + Intronic
1014799237 6:125759358-125759380 GGAGCAGGGCTGCGGGCAGGTGG - Exonic
1016585821 6:145683789-145683811 GGGGGCAAGCTGTGCTCAGGTGG - Intronic
1017233338 6:152095392-152095414 TGAGCCCAGCTGAGGTCAGGAGG - Intronic
1017988723 6:159467819-159467841 GGAGCCCAGCTGCACTAACGTGG + Intergenic
1022573852 7:31479071-31479093 GGAGCCGAGCTGGAATAAGGAGG - Intergenic
1024465429 7:49707148-49707170 GGCTCCCAGCTGCACTCAGGAGG - Intergenic
1025007563 7:55366126-55366148 GGAGGCGAGCAGCGCCCCGGCGG - Exonic
1032109825 7:129066489-129066511 GGAGCAGAGCTGAGCCGAGGCGG - Intergenic
1034622263 7:152464660-152464682 GGAGCCCGGCCGCGCTCGGGGGG + Intergenic
1035403835 7:158586397-158586419 GGAGCCCAGCTGCACTGAGGTGG + Intronic
1036293511 8:7516978-7517000 GGACCTGAGCTGGGCCCAGGAGG - Intergenic
1036329048 8:7804017-7804039 GGACCTGAGCTGGGCCCAGGAGG + Intergenic
1036850059 8:12194674-12194696 CGGGCTGGGCTGCGCTCAGGAGG + Intergenic
1036871423 8:12436947-12436969 CGGGCTGGGCTGCGCTCAGGAGG + Intergenic
1038639889 8:29315429-29315451 GGAGCGTACCAGCGCTCAGGTGG - Intergenic
1039936485 8:42051346-42051368 GGATCCGAGCGGGGCTGAGGCGG - Intronic
1040039041 8:42897451-42897473 GGGGCTGCGCTGCGCTCTGGGGG + Intronic
1042731664 8:71942170-71942192 GGAGCCAAGCTGGGTTTAGGTGG + Intronic
1045657881 8:104405835-104405857 GGAGGGGAGCAGCGCCCAGGAGG + Intronic
1049582659 8:143419963-143419985 GGAGCTGAGCTGGGCTGAGCTGG + Intronic
1054154662 9:61631740-61631762 GGAGTAGGGCTGCGCACAGGAGG + Intergenic
1061416433 9:130449622-130449644 GGAGCCGAGCTGATCTGAGTTGG + Intronic
1061666380 9:132162885-132162907 GGAACTGAGCGGCGCGCAGGTGG + Intronic
1062464016 9:136673338-136673360 GGAGCCCAGCTGCACCCTGGTGG + Exonic
1062468836 9:136693284-136693306 GGAGCCGGGCTGAGCACAGGGGG - Intergenic
1062557805 9:137123631-137123653 GGAGCCAGGTTGTGCTCAGGTGG - Intergenic
1190264035 X:48816862-48816884 GAAGCTGAGGTGAGCTCAGGAGG + Intronic