ID: 982235672

View in Genome Browser
Species Human (GRCh38)
Location 4:153249275-153249297
Sequence GCGGGAGCCGAGCTGCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235672_982235684 10 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235672_982235682 2 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235682 4:153249300-153249322 CGGGGCGGGGCCTGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 150
982235672_982235690 29 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235690 4:153249327-153249349 CGGGCCCCGGCAGAGCCTGCGGG 0: 1
1: 0
2: 0
3: 37
4: 291
982235672_982235686 16 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235686 4:153249314-153249336 TTGCTATGGAGCCCGGGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 138
982235672_982235683 9 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235672_982235689 28 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235689 4:153249326-153249348 CCGGGCCCCGGCAGAGCCTGCGG 0: 1
1: 0
2: 2
3: 38
4: 381
982235672_982235691 30 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235691 4:153249328-153249350 GGGCCCCGGCAGAGCCTGCGGGG 0: 1
1: 0
2: 3
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235672 Original CRISPR GCGGGAGCCGAGCTGCGCTC AGG (reversed) Intronic
900338556 1:2176867-2176889 GCAGCAGCCCAGCTGGGCTCTGG - Intronic
904404024 1:30274609-30274631 CCTGGAGCTGAGCTGCCCTCAGG + Intergenic
905203301 1:36328261-36328283 CCGGGAGCAGAGCTGTGCTTGGG - Exonic
905416468 1:37807942-37807964 GCCGTGGCCGAGCTGCGCGCCGG - Exonic
907389777 1:54150719-54150741 GAGGTAGCCGAGCTGGGCTCAGG - Intronic
908574953 1:65449617-65449639 GCTGGAGCCCAGCTTCCCTCCGG + Intronic
910163424 1:84298515-84298537 GCGGCCGCCGAGCTCCGCGCGGG + Exonic
911545995 1:99217731-99217753 GGGAGAGCCAAGCTGGGCTCTGG - Intergenic
923055977 1:230426145-230426167 GCGGGAGGCGAGCCGCGCGCGGG + Intergenic
1065020677 10:21499893-21499915 GCAGGAGCCGGGCTCCGCACTGG - Intergenic
1065099850 10:22321740-22321762 GCGGGGGCCGCGCGGGGCTCGGG + Intronic
1067291947 10:44950122-44950144 GCTGGGGCCCAGCTCCGCTCAGG - Intergenic
1069818440 10:71212994-71213016 GCGCGCCCCGAGCTCCGCTCCGG - Exonic
1073205891 10:101769149-101769171 GCGGGAGAGGAGCTGGGCACCGG - Intergenic
1075438468 10:122461661-122461683 GCGGGAGAAGAGCGGCGCGCGGG - Exonic
1077133797 11:988402-988424 CAGGGAGCCGACCTGCACTCGGG - Intronic
1080385818 11:31810602-31810624 GCGGGAGCGGCGCAGGGCTCGGG - Intronic
1081413148 11:42783677-42783699 GTGAGAGCCTAGCTGCTCTCAGG - Intergenic
1082076684 11:47980695-47980717 GCGGCAGCCGCGCTAGGCTCCGG + Exonic
1083278076 11:61608795-61608817 GGGAGAGCAGAGCTGGGCTCTGG - Intergenic
1083617933 11:64035690-64035712 GGGGGCGCCGCGCTGCGCACTGG - Intronic
1084129107 11:67119566-67119588 GCGGGAGCGGCGCGGCGCGCCGG - Intronic
1089785596 11:120904782-120904804 GTGGGATCCAAGCTGGGCTCTGG - Intronic
1090855660 11:130607733-130607755 GCGAGAGCCAAGCTGCTCTTTGG - Intergenic
1101612119 12:106302296-106302318 GCGGGGGCTGAGCGGGGCTCTGG - Intronic
1102490744 12:113288296-113288318 GCGGGAGCCGAGTGGCAGTCGGG + Intronic
1103325540 12:120117356-120117378 GCGGGAGCAGAGCTGCGAGGAGG + Intronic
1103842918 12:123879857-123879879 GCGGGAGCTGAGCATCGCGCGGG + Intronic
1106516979 13:30464837-30464859 GCGGGGTGCGAGCCGCGCTCTGG + Intronic
1108555294 13:51585066-51585088 GCGGGAGCCGGGTGGCCCTCGGG + Intronic
1108648036 13:52450145-52450167 GCGGGCGCCGGGCGGCGATCCGG - Intronic
1111951348 13:94711691-94711713 GCGGGCGCCGGGCTGCACGCGGG - Exonic
1112091785 13:96090756-96090778 GCGGGCTCCGAGCCGCGCCCCGG + Intergenic
1113580344 13:111424356-111424378 GCGTGAGCTGAGCTTCACTCAGG + Intergenic
1113790703 13:113026522-113026544 GAGGGAGCACAGCAGCGCTCAGG - Intronic
1117093014 14:52268752-52268774 GCGCCAGGCGAGCTGCGCCCTGG + Intronic
1117920458 14:60722412-60722434 GAGGGAGCCAAGCAGCGTTCGGG + Intronic
1121586347 14:95065534-95065556 GGGGGTGCAGAGCTGGGCTCTGG - Intergenic
1122418783 14:101562804-101562826 CCTGGAACCCAGCTGCGCTCAGG - Exonic
1122672926 14:103385750-103385772 GCGGGCGGCGGGCTGCGCTTCGG - Exonic
1123080044 14:105688083-105688105 GGGGGAGCCGGGCGGCGCTTGGG + Intergenic
1124971648 15:34495184-34495206 CCTGGAGCAGAGCTGCGCCCAGG + Intergenic
1129710875 15:77819744-77819766 GCGGGAGCCGGGCCGCCCGCGGG - Intronic
1129834286 15:78692221-78692243 GCTGGAGCTCAGCTGAGCTCGGG - Intronic
1130145320 15:81269561-81269583 GCACGAGCTGAGCTGTGCTCAGG - Exonic
1130979506 15:88803219-88803241 GGGGAAGCCGGCCTGCGCTCAGG - Intergenic
1132983638 16:2752348-2752370 GCGGGAGACGAGACGCGCTCGGG + Exonic
1142181490 16:88673037-88673059 GCAGGTGCTGAGCTGCTCTCAGG + Intergenic
1142286350 16:89173078-89173100 GCAGGAGCCGTGGTGCCCTCAGG - Intronic
1142586889 17:979523-979545 GCTGGCGCTGAGCTGCGCGCAGG + Exonic
1143490223 17:7281750-7281772 GCGGGAGCCCCACTGCTCTCCGG + Exonic
1144021177 17:11241106-11241128 GCCTGAGCCGAGCCGCGCGCGGG + Intergenic
1144547975 17:16215378-16215400 GTGGGAGCCGACGTGCGCCCCGG + Exonic
1144855464 17:18264964-18264986 GAGGCAGCCCAGCTGCACTCAGG - Exonic
1145903318 17:28501758-28501780 GATGGAGCTGAGCTGGGCTCTGG - Intronic
1146307582 17:31742469-31742491 GAGGGAGCAGAGCTGAGCTAGGG - Intergenic
1147662206 17:42122733-42122755 GAGCGAGCGGAGCTGAGCTCGGG + Exonic
1148582783 17:48755032-48755054 GCTGGAGCCGGGATGCCCTCCGG + Intergenic
1149314036 17:55421980-55422002 GCGGGGGCGGAGCCGGGCTCCGG - Exonic
1149597826 17:57874576-57874598 CCGGGCTCCGAGCTGCCCTCAGG - Intronic
1151185268 17:72359540-72359562 GCAGGAGAGGAGCTGGGCTCTGG + Intergenic
1151468904 17:74305494-74305516 GAGGGAGCCCAGCTGGGCCCCGG + Intronic
1152552285 17:81035634-81035656 GCGGGAACGGAGCCGCGCGCCGG + Intronic
1152648454 17:81481228-81481250 GAGGGAAGCGAGCGGCGCTCAGG - Intergenic
1157251376 18:46098844-46098866 ACGTGATCCGATCTGCGCTCAGG + Intronic
1157564609 18:48671316-48671338 GCAGGAGTCTAGCTGCTCTCAGG + Intronic
1157804907 18:50650705-50650727 GCTGGAGCCAGGCTGCCCTCAGG - Intronic
1157849063 18:51030516-51030538 GCGGGGGCCGAGGAGCTCTCCGG + Exonic
1160541492 18:79626308-79626330 GCAGGAGCCGAGTTCCCCTCTGG - Intergenic
1161089128 19:2351522-2351544 GCTGGTGACGAGCTGCGCTGTGG + Exonic
1161960464 19:7520313-7520335 GCTGGAGCAGCGCTGAGCTCTGG - Exonic
1162646286 19:12052657-12052679 CCGAGGGCCGAGCTGCGCTAGGG + Intronic
1166807560 19:45496545-45496567 GCGGGGGGCGCGCTGCGCTCTGG - Intronic
1168326529 19:55541339-55541361 GCGGGGGTCGGGCTGCCCTCTGG + Exonic
927558047 2:24049785-24049807 GCCGGAGCCGAGCCGGGGTCGGG + Exonic
932180695 2:69643678-69643700 GCGGGAGCCGAGCGCGGCCCCGG - Exonic
932604614 2:73156815-73156837 CCGGGAGCCGAGCTGCTCACTGG - Intergenic
935196728 2:100820514-100820536 GCGGGGGCGGAGGGGCGCTCAGG + Intronic
936060942 2:109295429-109295451 GCGGGAGCCGAGGGGCACGCAGG + Intronic
938066015 2:128282482-128282504 GCGGGTGCAGAGCTGGGCTGCGG + Intronic
940774906 2:157875785-157875807 GCGGGACCCGAGGTGAGCGCAGG - Intronic
942084214 2:172428668-172428690 GCAGGAGCCGAGCGGGTCTCGGG - Intronic
942240925 2:173964108-173964130 GCGGGCGGCGGGCTGCGCGCCGG + Intronic
946418330 2:219551660-219551682 GAGGGGGCCGAGCTGTGCCCGGG - Exonic
949022389 2:241748899-241748921 GCGGCAGCCGGGCTGGCCTCGGG - Intronic
1173516218 20:43667210-43667232 GCGGGAGCCGGGCCGGGGTCAGG - Exonic
1173528350 20:43749925-43749947 GCCGGGGCCGTGCTGCCCTCTGG - Intergenic
1174506919 20:51023028-51023050 GCGGGAGCTGAGCCGGGCCCCGG - Exonic
1176062203 20:63177383-63177405 GCGTGAGCCGAGGAGCGCGCGGG + Intergenic
1177225176 21:18244815-18244837 GCAGCAGCCGCTCTGCGCTCAGG - Exonic
1178697138 21:34803126-34803148 GCTGGAGAGGAGCTGGGCTCAGG + Intronic
1179914578 21:44467864-44467886 CCGGGAGCAGAGCTGCTCTCGGG - Intergenic
1180959502 22:19756221-19756243 GCGGCAGCCTACCTGCGCTAGGG + Intergenic
1181047881 22:20224155-20224177 GCAGGAGCCGAGCGGTGGTCAGG + Intergenic
1183444499 22:37844195-37844217 GCGGACGACGAGCCGCGCTCAGG - Exonic
1184164549 22:42720084-42720106 GCGGGAGCGGAACTGGGCTTGGG - Intronic
1184478284 22:44733364-44733386 GCGGGAGCCCAGCTTCACCCCGG + Intronic
1184660558 22:45963722-45963744 GTGGAAGCCCAGCTGGGCTCTGG + Intronic
961393422 3:126570119-126570141 GCAGGAGCAGAGCAGGGCTCAGG - Intergenic
964771145 3:160225536-160225558 GCGGGACCCGAGCGGAGCGCCGG + Intergenic
968433779 4:575032-575054 GCGGGCGCGGAGGTGCGCTGCGG - Intergenic
968556435 4:1248475-1248497 GCGGGAGCCGTGCGCAGCTCGGG - Intronic
968653380 4:1768643-1768665 GCGAGGGTCGAGCTGCGCTTGGG - Intergenic
968659674 4:1793836-1793858 GCGGGAGGCGGGCGCCGCTCGGG - Exonic
978731283 4:112029795-112029817 GCGGCAGATGGGCTGCGCTCTGG + Intergenic
980730115 4:136812761-136812783 GTGGAAGCCGAGCTGGGCCCAGG - Intergenic
981143943 4:141303469-141303491 GGGGAAGCCCAGCTGCACTCAGG - Intergenic
982235672 4:153249275-153249297 GCGGGAGCCGAGCTGCGCTCAGG - Intronic
986848817 5:11786107-11786129 GCGGCAGCAGGGCTGAGCTCTGG + Intronic
989209503 5:38845707-38845729 GCAGGAGCAGCGCTGCGCGCGGG + Intergenic
992088770 5:73299876-73299898 GCGGGAGCCGAGCACGGCTGGGG - Intergenic
997608200 5:135191713-135191735 GCGGGAGCCAGGCTGCGCCATGG + Intronic
1001556664 5:172641573-172641595 GCGCGCGCCGAGCTGAGGTCCGG - Intronic
1002169479 5:177367224-177367246 GGCGGAGCCTAGCTGAGCTCGGG + Intronic
1006083590 6:31581248-31581270 GCGGGAGCCGAGCCGGGCCGGGG + Intronic
1006606245 6:35259721-35259743 GCGCGAGGCAAGCTGCGCGCGGG + Exonic
1007783093 6:44265237-44265259 GCTGGAGCCGAGGTGGACTCGGG + Exonic
1019530383 7:1500129-1500151 GCAGGAGGCGAGCAGCGCTGGGG - Intronic
1019917835 7:4144798-4144820 GGGGGAACAGAGCCGCGCTCCGG - Intronic
1020035880 7:4962839-4962861 CCTGGAGCCCAGCTGGGCTCTGG + Intergenic
1020137103 7:5593701-5593723 TCTGGAGCAGAGCTGCGCCCAGG + Exonic
1021411309 7:20331722-20331744 GCGGGCCCCGAGGTGCGCCCGGG + Exonic
1021868333 7:24980067-24980089 GCCGGAGCCGCGCTGCGCACCGG + Exonic
1022095669 7:27139620-27139642 CCGAGGGCCGCGCTGCGCTCAGG - Intronic
1034622260 7:152464657-152464679 GCGGGAGCCCGGCCGCGCTCGGG + Intergenic
1035403833 7:158586394-158586416 GCCGGAGCCCAGCTGCACTGAGG + Intronic
1035515944 8:232394-232416 TCCGGAGCCGAGGTCCGCTCGGG + Exonic
1039467952 8:37797217-37797239 GCTGGGGCCGGGCTGCGCGCCGG - Intronic
1040039038 8:42897448-42897470 GCTGGGGCTGCGCTGCGCTCTGG + Intronic
1040543715 8:48380870-48380892 GCGGGAGCCGCGCTGAGGGCAGG + Intergenic
1047732086 8:127736299-127736321 GGGCGAGCAGAGCTGCGCTGCGG + Exonic
1047998468 8:130358234-130358256 GCGGGTGGCGGGCTGCGCGCCGG - Intronic
1048009364 8:130443633-130443655 GCGGGAGCCGAGCGCGGCGCAGG + Exonic
1049190139 8:141282806-141282828 GCGGGAAAGGAGCTGAGCTCAGG - Intronic
1049194643 8:141308515-141308537 GCGGGAGCCACGGTGCGCGCGGG - Intergenic
1057619127 9:96619476-96619498 GCGGGCGCAGAGCGGCGCTGCGG + Exonic
1058663077 9:107283603-107283625 CCGGCAGCCGAGCTGCGCGGCGG + Exonic
1059483686 9:114611447-114611469 GCGGGAGGCGTGCTGGGCGCGGG + Exonic
1059941830 9:119367391-119367413 GCGGCAGCCGTTCTGCTCTCAGG - Intronic
1061408084 9:130403569-130403591 GGGGCAGCTGAGCTGGGCTCAGG + Intronic
1062468839 9:136693287-136693309 GTGGGAGCCGGGCTGAGCACAGG - Intergenic
1062537596 9:137027757-137027779 GCGGGGGGCAAGCGGCGCTCAGG - Exonic
1188451238 X:30309493-30309515 GGGGGCGCGGTGCTGCGCTCCGG + Exonic
1195944454 X:110193820-110193842 GCGGGAGCTTAGCTGTGCTTAGG - Intergenic
1199942186 X:152637754-152637776 GCGGGGGCCGGGCGGCGCGCAGG + Intergenic