ID: 982235679

View in Genome Browser
Species Human (GRCh38)
Location 4:153249293-153249315
Sequence AACAGGCCCCGCCCCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235679_982235684 -8 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235679_982235696 26 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235696 4:153249342-153249364 CCTGCGGGGTGAAAGCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 108
982235679_982235697 27 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235697 4:153249343-153249365 CTGCGGGGTGAAAGCCCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
982235679_982235691 12 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235691 4:153249328-153249350 GGGCCCCGGCAGAGCCTGCGGGG 0: 1
1: 0
2: 3
3: 36
4: 296
982235679_982235683 -9 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235679_982235686 -2 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235686 4:153249314-153249336 TTGCTATGGAGCCCGGGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 138
982235679_982235690 11 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235690 4:153249327-153249349 CGGGCCCCGGCAGAGCCTGCGGG 0: 1
1: 0
2: 0
3: 37
4: 291
982235679_982235689 10 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235689 4:153249326-153249348 CCGGGCCCCGGCAGAGCCTGCGG 0: 1
1: 0
2: 2
3: 38
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235679 Original CRISPR AACAGGCCCCGCCCCGAGGC GGG (reversed) Intronic
901704014 1:11060048-11060070 GGCAGGCCCCGCCCCGCGCCCGG - Intergenic
902642918 1:17778255-17778277 AGCAGGCCCTGCACCAAGGCTGG - Intronic
903184341 1:21620718-21620740 CCCAGGCCCAGCCCCGAGCCGGG - Intronic
903738163 1:25543530-25543552 GACAGGCCCCGCCCCCAGACGGG - Intergenic
904496601 1:30890855-30890877 CACAGCCCCCGCCCCCAGACAGG + Intronic
904690927 1:32292656-32292678 CGCAGGCCCCGCTCAGAGGCTGG - Intronic
904783858 1:32970895-32970917 AAGAGGCCACTCCCTGAGGCAGG - Intergenic
904809011 1:33151287-33151309 GGCAGGCCCTGCCCCTAGGCCGG - Intronic
905270822 1:36786457-36786479 AACTGGGCTCTCCCCGAGGCTGG + Intergenic
907136575 1:52144073-52144095 AAGATGCCCCTCTCCGAGGCGGG + Intronic
908012039 1:59787794-59787816 TACAGGCCCTGCACAGAGGCAGG + Intergenic
909807908 1:79894305-79894327 CACAGGCCCCTCCCCCAGCCAGG + Intergenic
913591540 1:120333266-120333288 AACAGGCCGGGCACCGTGGCTGG + Intergenic
913651816 1:120921857-120921879 AACAGGCCGGGCACCGTGGCTGG - Intergenic
914169285 1:145207206-145207228 AACAGGCCGGGCACCGTGGCTGG + Intergenic
914524405 1:148451173-148451195 AACAGGCCGGGCACCGTGGCTGG + Intergenic
914599268 1:149184684-149184706 AACAGGCCGGGCACCGTGGCTGG - Intergenic
914641998 1:149615968-149615990 AACAGGCCGGGCACCGTGGCTGG - Intergenic
916170774 1:162000077-162000099 AACAGGGCCGCCCCAGAGGCAGG - Intronic
917937520 1:179882995-179883017 AACAGTCCCAGCCGCGAGCCAGG + Intronic
920440711 1:205978799-205978821 AACAGAGCCTGCCCCGAGCCTGG - Exonic
921866767 1:220094492-220094514 TGGAGGCCCCGCGCCGAGGCGGG - Intronic
1067300217 10:45001099-45001121 GCCAGGCCCTGCCCGGAGGCGGG - Intronic
1070258017 10:74826971-74826993 GACAGGCCCCGCCCCTCGGCAGG + Intronic
1073151984 10:101318228-101318250 AACAGGGCCCGCGGGGAGGCAGG - Intergenic
1074108892 10:110408715-110408737 TGCAGGCCCTGCCCCGAGGGCGG + Intergenic
1075713392 10:124542608-124542630 AACTGCCCCCTCCCCCAGGCTGG - Intronic
1076696675 10:132250599-132250621 GAGGGGCTCCGCCCCGAGGCAGG + Intronic
1076738568 10:132469413-132469435 AACCAGCCCCACCCCGTGGCTGG - Intergenic
1076749924 10:132537546-132537568 AGGAGGCCCCGCCCCGGGGCAGG + Intergenic
1076749979 10:132537717-132537739 CACAGGCCCCACCCCGAGTCAGG + Intergenic
1076870211 10:133189272-133189294 CACAGGCCCCGTCCCGAGTCAGG - Intronic
1077236244 11:1483303-1483325 AGCAGGCCCCGGCCGCAGGCAGG + Intronic
1077328389 11:1973425-1973447 AAAGGGCCCCACCCCGAGGGAGG + Intronic
1077529224 11:3087469-3087491 AGCTGGCCCCGCACCCAGGCCGG - Exonic
1080614532 11:33934685-33934707 AACAGCCCCCGCTCCTAGCCAGG + Intergenic
1085016497 11:73177490-73177512 CACAGGCCCAGCCCCTGGGCTGG - Intergenic
1088259139 11:107928375-107928397 CAGAGGCCCCGCCCCTAGCCGGG + Intergenic
1089525663 11:119094942-119094964 AAGAGGGCCCGCGCCGCGGCCGG - Exonic
1091046750 11:132332214-132332236 AACAGGGGTAGCCCCGAGGCAGG - Intronic
1202811367 11_KI270721v1_random:28604-28626 AAAGGGCCCCACCCCGAGGGAGG + Intergenic
1091556503 12:1577560-1577582 ACCTGCCCCCGCCCCCAGGCTGG + Intronic
1091995375 12:4988867-4988889 ACCAGTCCCTGCTCCGAGGCTGG - Intergenic
1102349211 12:112179686-112179708 GACAGGCCCCTCCCCGAGGGTGG + Intronic
1105830602 13:24160668-24160690 ACCAGGCCACGCCCCCAGCCCGG - Intronic
1106208750 13:27621774-27621796 CCCAGCCCCCGCCCCGACGCGGG - Exonic
1106208758 13:27621805-27621827 CTCATGCCCCGCCCCGCGGCTGG + Exonic
1107067133 13:36226555-36226577 AACAGTCCACGGCCAGAGGCTGG + Intronic
1113517571 13:110915100-110915122 GCCAGGCCCCGCCCCCAGCCCGG - Intergenic
1117978543 14:61321172-61321194 AAGAGGCCCTGGCCGGAGGCGGG - Intronic
1118641742 14:67798888-67798910 ACCAGGCCCCGCCCCCGGGGAGG + Intronic
1122882669 14:104697055-104697077 AACAGGCCAAGCCCTGAGCCTGG - Intronic
1123166600 14:106330989-106331011 AACAGGTGCAGCCCCAAGGCAGG - Intergenic
1123169284 14:106356028-106356050 AACAGGTGCAGCCCCAAGGCAGG - Intergenic
1124637788 15:31375909-31375931 CCCAGGCCCCACACCGAGGCAGG + Exonic
1125755320 15:42060368-42060390 ACCAGCCCCCACCCCGAGGAGGG + Intergenic
1129151526 15:73691580-73691602 AACATGCCCAGGCCCTAGGCTGG + Intronic
1129879336 15:78996629-78996651 AACAGGCTCCCCTCCGAGGGTGG + Intronic
1130302322 15:82689335-82689357 CCCAGGCCCCGCCCGGAGGGAGG + Intronic
1132662838 16:1069269-1069291 AGCAGGCCCCGCCCCCCAGCTGG + Intergenic
1132662853 16:1069323-1069345 AGCAGGCCCCGCCCCCCAGCTGG + Intergenic
1132662867 16:1069377-1069399 AGCAGGCCCCGCCCCCCAGCTGG + Intergenic
1132695942 16:1202059-1202081 CGCAGGCCCGGCCCCGAGCCAGG + Exonic
1133802230 16:9092631-9092653 GGCAGTCCCCGCCCCGAGGCCGG - Intronic
1135969189 16:27060071-27060093 GACAGGGCCTGCCCCGAAGCGGG - Intergenic
1136301022 16:29334294-29334316 CACAGGCCCCGGCCCCAGGATGG - Intergenic
1136401574 16:30021957-30021979 ACCAAGCCCAGCCCAGAGGCAGG - Intronic
1137655159 16:50153219-50153241 CAGAGGCCCCGCCCCGGGGCCGG + Intronic
1138376020 16:56564689-56564711 ATGAGGCCCCGAGCCGAGGCAGG + Intergenic
1138387806 16:56648104-56648126 CAGAGGCCCCGCCCCAAGTCTGG - Intronic
1141618011 16:85221125-85221147 TGCAGCCCCCGCCCAGAGGCAGG + Intergenic
1141709409 16:85689156-85689178 GACAGGCCCCGCCCCCACCCCGG + Intronic
1143374114 17:6457427-6457449 CACAGGCCCTGGCCCAAGGCAGG + Intronic
1144574163 17:16418451-16418473 GGCAGGCCCCGCCCCCGGGCAGG - Intronic
1146541801 17:33702565-33702587 AAAAGGCCTTGCCCCGAGGGAGG + Intronic
1151893328 17:76963944-76963966 CACAGGCCCCTCCCGGAGGTGGG + Intergenic
1152643679 17:81459345-81459367 GCCAGGCCCCTCCCCGGGGCGGG - Intronic
1157473665 18:48008258-48008280 AACCGACCCCGCCCCGCCGCGGG + Intergenic
1159045798 18:63367403-63367425 TGCGGGCCCCGTCCCGAGGCCGG - Exonic
1161084882 19:2330402-2330424 ACCGTGCCCGGCCCCGAGGCAGG + Intronic
1161280140 19:3441566-3441588 AACAGGCCTGGCCCCTGGGCTGG + Intronic
1161400888 19:4065893-4065915 TCCAGGCCCCGCCCCCTGGCGGG + Intronic
1161721451 19:5904816-5904838 CACAGGCCCCGCCCCCGGGAGGG - Intergenic
1162038496 19:7955432-7955454 AATAGCCCCCCCCCAGAGGCGGG + Intergenic
1162901014 19:13795611-13795633 AAGAGGCCCCGCCCCGGCCCTGG + Exonic
1162937197 19:13987137-13987159 AACAGGGGCCGCCCCGAAGGAGG - Intronic
1163597113 19:18226514-18226536 CATCGGCCCCGCCTCGAGGCCGG + Intronic
1165851066 19:38850621-38850643 TTCAGGCACCGCCCAGAGGCGGG + Intronic
1166777254 19:45320614-45320636 AACGGGCCCCTCCCGGAGGCTGG + Intronic
1166799019 19:45444444-45444466 AACAGGCCCCGCCCCGCCCCAGG + Intronic
1166881701 19:45934103-45934125 AAAAGGCCCAGGCCCCAGGCTGG - Exonic
1166994497 19:46713826-46713848 CCGAGGCCCCGCCCCCAGGCCGG + Intronic
1167154595 19:47730310-47730332 CACAGGCCCCGCCCCCAGCCCGG + Intronic
1167903241 19:52637833-52637855 AGCAGGGCCCGCCACGAGGAGGG + Intronic
1168056482 19:53867743-53867765 TCCCAGCCCCGCCCCGAGGCGGG - Intronic
1168649610 19:58085088-58085110 AAGAGGCCGCACCCCGAGGATGG - Exonic
927639856 2:24839674-24839696 AAGAGGCCTCACCCCAAGGCAGG + Intronic
928337200 2:30408074-30408096 TTCAGGCCCCGACGCGAGGCAGG + Intergenic
935331573 2:101981190-101981212 AACAGGCCCCTCCCTGAGCTTGG - Intergenic
936076887 2:109407093-109407115 AAGAGCCCCTGCCCAGAGGCAGG - Intronic
937208658 2:120253100-120253122 GACATGTCGCGCCCCGAGGCCGG + Intronic
938374616 2:130797517-130797539 GTCAGGCCCCGCCCCGTGGCTGG - Intergenic
939629567 2:144516597-144516619 AGCAGGCTCTGCCCCCAGGCCGG - Intronic
941666324 2:168247177-168247199 CACAGGCCGGGCGCCGAGGCCGG - Intronic
945088776 2:206159607-206159629 AAGACGCCCGGCCTCGAGGCTGG - Exonic
945558824 2:211312755-211312777 AACAGGCCCTCACCAGAGGCTGG + Intergenic
947215516 2:227746229-227746251 TACAGCCCCTGCCCAGAGGCTGG - Intergenic
948578424 2:238968793-238968815 AGCAGGCCCAGCCCCCAGGATGG - Intergenic
948813890 2:240499891-240499913 AACAGCCCCAGGCACGAGGCCGG + Intronic
1169801439 20:9515941-9515963 TACAGCCCCCGCCCCGGGGCCGG + Intronic
1172447546 20:35001106-35001128 AACAGGCCGCCCTCCGTGGCGGG + Exonic
1172874502 20:38156072-38156094 CACAGGCCCAGCCCCTAGCCAGG - Exonic
1173569799 20:44068757-44068779 AAGAGGCCCTGGCCAGAGGCAGG + Exonic
1173773427 20:45683625-45683647 GACAGGCCATGCCCAGAGGCAGG - Intergenic
1174171576 20:48621046-48621068 TCCAGGCCCCGCCTCCAGGCTGG + Intergenic
1175287814 20:57849555-57849577 AACAGGCCACGAACCGTGGCTGG - Intergenic
1176200957 20:63860356-63860378 AACAGGCCCCGCCCCTAGTTGGG - Intergenic
1177792508 21:25735624-25735646 AAAAGGCCCCGGAACGAGGCCGG - Intronic
1178894607 21:36548439-36548461 AACAGCCCCGCCCCAGAGGCAGG + Intronic
1179783860 21:43719027-43719049 CGCAGGCCCCGCCCCCGGGCTGG - Intergenic
1179878955 21:44285591-44285613 AGCAGGGCCCTCGCCGAGGCAGG + Intergenic
1180201696 21:46228624-46228646 CCCAGGCCCCGCCCCAACGCCGG + Intronic
1180682567 22:17638705-17638727 TTCAGGTCCCGCCCCGACGCCGG + Exonic
1181310660 22:21942924-21942946 AACAGCCCCTGCCCCAAGGTCGG - Intronic
1181776801 22:25165940-25165962 ACCAGGCCCCGCACCCATGCAGG + Intronic
1182123701 22:27801821-27801843 AGCGAGCCCCGCCCCGAGCCCGG - Intergenic
1184822111 22:46917328-46917350 AGCAGGCCCAGACCAGAGGCCGG + Intronic
1185249090 22:49790165-49790187 CACAGGCCCCTCCCCCAGCCGGG + Intronic
1185301422 22:50083204-50083226 AACGCGCCCCGTCCCCAGGCTGG + Intronic
1185313736 22:50170238-50170260 AACAGCCCCCTCCCCGCGGCGGG + Intergenic
954327193 3:49869972-49869994 AACCGGCCCCGCCCCGACCCTGG + Exonic
954752540 3:52821720-52821742 CACAGGCCCCTCCCTGAGGGAGG - Intronic
955972101 3:64445750-64445772 AACGGTCCCTGCCCCTAGGCTGG - Intergenic
960747668 3:120908146-120908168 GGCAGGCCCCGCCCCCGGGCCGG - Exonic
966235901 3:177701118-177701140 AACAGGCCACAGGCCGAGGCTGG - Intergenic
968114763 3:196081454-196081476 AACGGGGCCCGCCCGGAGCCCGG + Intronic
968506581 4:973728-973750 CACAGGCCCCGCCCCTTAGCAGG - Intronic
969208134 4:5664650-5664672 AACAGGCTCCTCACCCAGGCTGG + Intronic
970188260 4:13484709-13484731 GACAGGCCCCGCCCCGCCGCCGG - Intergenic
973265349 4:48204860-48204882 AACAGGCCACGCACCGAAACCGG + Intronic
982235679 4:153249293-153249315 AACAGGCCCCGCCCCGAGGCGGG - Intronic
983533416 4:168833065-168833087 GGCCGGCCCCGCCCCGGGGCTGG + Intronic
984992695 4:185396574-185396596 CGCGGGCCCCGCCCCGAGGTGGG + Exonic
985549169 5:524492-524514 GGCAGGCTCCGCCCCGGGGCGGG - Intergenic
986009394 5:3698577-3698599 AACAGACCCCACTCTGAGGCTGG - Intergenic
996302840 5:122008359-122008381 CACAGGCCCCGACTCCAGGCTGG - Intronic
1000843990 5:166256732-166256754 TACTACCCCCGCCCCGAGGCCGG + Intergenic
1002350067 5:178577216-178577238 AGCAGGCCCCGCCAGGACGCGGG - Intronic
1006890172 6:37420323-37420345 ACCATGCCCGGCCCCAAGGCAGG + Intergenic
1007719152 6:43875205-43875227 AAGAGGCACCTCCCCCAGGCTGG - Intergenic
1017000718 6:149995535-149995557 GGCAGCCCCCACCCCGAGGCTGG - Intergenic
1017163773 6:151390277-151390299 CCCCGGCCCCGCCCCGGGGCGGG - Intronic
1017566873 6:155696311-155696333 AAAGGCCCCCACCCCGAGGCAGG + Intergenic
1018872761 6:167796015-167796037 TGCAGGAGCCGCCCCGAGGCAGG + Intronic
1019316323 7:388617-388639 ACCAGGCCCCATCCTGAGGCTGG + Intergenic
1019943301 7:4308092-4308114 AACAGGCTGTGCCCAGAGGCGGG - Intergenic
1022923271 7:35037207-35037229 AAGGGGCCCCGCGCCGAGCCCGG - Intronic
1032055860 7:128683755-128683777 ACCAGGCCCAGCCTCGAGTCTGG + Exonic
1033637425 7:143225270-143225292 GGCAGGCCCAGCCCAGAGGCAGG + Intergenic
1035374232 7:158396775-158396797 AACAGGACAGACCCCGAGGCGGG - Intronic
1035560870 8:602604-602626 CCCAGGCCCCTCCCTGAGGCTGG + Intergenic
1038406212 8:27324913-27324935 CAGGGGCCCCGCCCAGAGGCTGG - Intronic
1039918470 8:41876379-41876401 AACAGGCCCCACCCGGAGAGGGG + Intronic
1049796867 8:144500987-144501009 AGCAGGCCCCGCCCCGGGCTTGG + Intronic
1049802147 8:144522842-144522864 AGCGAGCCCCGGCCCGAGGCGGG - Exonic
1053151901 9:35749033-35749055 ACCAGGCACCGCCCCGGGACGGG + Exonic
1053313856 9:37035893-37035915 AACACCCCCCGCCCCCAGCCCGG - Intergenic
1058702869 9:107615147-107615169 AGCAGCCCCCACCCCCAGGCTGG + Intergenic
1059352195 9:113673377-113673399 CACAGGCCCATCCCTGAGGCAGG - Intergenic
1060549258 9:124477413-124477435 ACCAGGCCCCTCCCAGGGGCAGG + Intronic
1061009489 9:127946572-127946594 AAGAGGCCCCTCCCCCAGGCAGG - Intronic
1061061596 9:128253380-128253402 AACAGGCTCCGCGCCCAAGCTGG + Intronic
1062442830 9:136578798-136578820 TACAGGCCCCGCCCCAGGCCAGG - Intergenic
1062495795 9:136831004-136831026 AACGGGCCCCTCACCAAGGCCGG - Intronic
1192274472 X:69615932-69615954 CCCAGGCCCCGCCCCGCGGCTGG + Intergenic