ID: 982235680

View in Genome Browser
Species Human (GRCh38)
Location 4:153249294-153249316
Sequence CAACAGGCCCCGCCCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235680_982235684 -9 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235684 4:153249308-153249330 GGCCTGTTGCTATGGAGCCCGGG No data
982235680_982235689 9 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235689 4:153249326-153249348 CCGGGCCCCGGCAGAGCCTGCGG 0: 1
1: 0
2: 2
3: 38
4: 381
982235680_982235690 10 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235690 4:153249327-153249349 CGGGCCCCGGCAGAGCCTGCGGG 0: 1
1: 0
2: 0
3: 37
4: 291
982235680_982235683 -10 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235680_982235697 26 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235697 4:153249343-153249365 CTGCGGGGTGAAAGCCCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
982235680_982235696 25 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235696 4:153249342-153249364 CCTGCGGGGTGAAAGCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 108
982235680_982235691 11 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235691 4:153249328-153249350 GGGCCCCGGCAGAGCCTGCGGGG 0: 1
1: 0
2: 3
3: 36
4: 296
982235680_982235686 -3 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235686 4:153249314-153249336 TTGCTATGGAGCCCGGGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235680 Original CRISPR CAACAGGCCCCGCCCCGAGG CGG (reversed) Intronic
900113486 1:1019461-1019483 CCCCAGGCCCCGCCGCGGGGAGG - Intergenic
901608187 1:10475374-10475396 AAACAGGCCCCTCCCCGGAGGGG - Intronic
903738164 1:25543531-25543553 GGACAGGCCCCGCCCCCAGACGG - Intergenic
904471911 1:30741408-30741430 CACCATGCCCGGCCCCGTGGAGG + Intronic
904578740 1:31523950-31523972 TCACATGCCCCACCCCGAGGAGG + Intergenic
907136574 1:52144072-52144094 CAAGATGCCCCTCTCCGAGGCGG + Intronic
914747509 1:150510944-150510966 CAACAGGACCGGTCCCAAGGGGG + Exonic
918423524 1:184386894-184386916 CCGCAGGCCCCGCCCCGGGGAGG + Intergenic
919763322 1:201111810-201111832 AAACAGGCCCCACCCATAGGTGG + Intronic
920070510 1:203299457-203299479 CTGCAGGCCCCTCCCCAAGGTGG - Intergenic
921866768 1:220094493-220094515 CTGGAGGCCCCGCGCCGAGGCGG - Intronic
922707486 1:227796939-227796961 CAGCAGGCCAGGCCTCGAGGTGG - Intergenic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1067711688 10:48655826-48655848 CACCTGGCAGCGCCCCGAGGTGG + Intronic
1068115968 10:52738389-52738411 CAACAGGCCCCGCTCCTAGCTGG + Intergenic
1072784009 10:98268274-98268296 CCGCAGGCCCCGCCCCGGGCGGG + Intergenic
1075992314 10:126848479-126848501 CACCAGGCCCCACTCAGAGGTGG + Intergenic
1077198583 11:1293773-1293795 CACCAGGCCCTGCCAGGAGGTGG + Intronic
1079294341 11:19218921-19218943 CAGCAGGACCCGCCCTCAGGAGG + Intergenic
1083258560 11:61510804-61510826 CACCAGGGACAGCCCCGAGGGGG + Exonic
1083571925 11:63765678-63765700 AAACAGACCCCACCCAGAGGAGG + Intronic
1085256337 11:75175750-75175772 CCACAGCCCCTGCCCCGAGGAGG + Intronic
1086295756 11:85365918-85365940 CAACAGGTCCTGCCAGGAGGTGG + Intronic
1088259138 11:107928374-107928396 CCAGAGGCCCCGCCCCTAGCCGG + Intergenic
1088342900 11:108789001-108789023 CAACAGGGCCAGCCCAGAGAGGG - Intronic
1090404474 11:126468519-126468541 CACCAGGCCCCTTCCCCAGGAGG - Intronic
1092446723 12:8564757-8564779 CCGCAGGTGCCGCCCCGAGGAGG + Intergenic
1094184480 12:27626395-27626417 CAACAAGCCCTGCCCAGATGAGG - Intronic
1094510205 12:31091886-31091908 CAGCAGGCCCTGGCCCGGGGAGG - Intronic
1096551484 12:52376386-52376408 CAAGAGGCCCCGCCCAGACTTGG - Intergenic
1099989703 12:89709078-89709100 CCGCGGGCCCCGCCCCGAGTGGG - Intronic
1103114069 12:118309802-118309824 CATCAGGCCCCGCCACATGGTGG + Intronic
1103225740 12:119285837-119285859 CACTAGGCCCGGCCCCAAGGGGG + Intergenic
1104355103 12:128078304-128078326 CAACAGGCCCTGCACCAAAGTGG + Intergenic
1104980061 12:132569725-132569747 CTCCAGGCCCCGCCCGGCGGAGG - Intronic
1106187810 13:27424579-27424601 CACCAGGCACCGCCCCGCGTCGG - Exonic
1106208752 13:27621775-27621797 CCCCAGCCCCCGCCCCGACGCGG - Exonic
1113735065 13:112672582-112672604 CAGCAGGCCCCACCAAGAGGAGG + Intronic
1113909432 13:113835149-113835171 CAACAGGGCCCTCCCCATGGCGG + Intronic
1114601149 14:23956368-23956390 CTACAGGCCTGGCCCAGAGGTGG + Intronic
1114610836 14:24039138-24039160 CTACAGGCCTGGCCCAGAGGTGG + Intergenic
1115628490 14:35219333-35219355 CAGAAGGCCCCACCCTGAGGTGG - Intronic
1117978544 14:61321173-61321195 CAAGAGGCCCTGGCCGGAGGCGG - Intronic
1121886384 14:97546711-97546733 CACCAGGCCCCGCCAGGCGGTGG + Intergenic
1123758841 15:23417120-23417142 CATGAGGCCCCGCCCCCAGCCGG - Intergenic
1124291613 15:28457135-28457157 CAGCAGGCCCTGCCCCGGGATGG + Intergenic
1125755319 15:42060367-42060389 GACCAGCCCCCACCCCGAGGAGG + Intergenic
1126436917 15:48645901-48645923 CGAGAGGCCCCGCACCGAGGCGG - Intergenic
1127863046 15:63010401-63010423 CAACAGGCCCCAGGCAGAGGAGG + Intergenic
1128529163 15:68432133-68432155 CTGCAGGCGCCGCGCCGAGGAGG - Exonic
1131562625 15:93457671-93457693 CACCCGCCCCCGCCCCCAGGTGG - Intergenic
1132991579 16:2798403-2798425 CAACCCGCCCTGCCCCCAGGGGG + Intergenic
1132994736 16:2817187-2817209 CACCCCGCCCCGCCCCCAGGGGG + Intronic
1133286193 16:4691994-4692016 CATCAGTCCCTGCCCCGAGAAGG + Intergenic
1134457498 16:14405740-14405762 CATGAGGCCCCGCCCCCAGCCGG + Intergenic
1138591422 16:58001354-58001376 CTCCCGGCTCCGCCCCGAGGCGG + Exonic
1139373919 16:66485073-66485095 CAACAGGCATCGCCCAGAAGAGG + Intronic
1144148262 17:12419372-12419394 CACCAGGCCCCGCCCCTAGAGGG - Intergenic
1146003943 17:29149102-29149124 CTCCAGGCCCCACCCCCAGGAGG + Intronic
1146053138 17:29567971-29567993 CCACAGGCCTCACCCCCAGGAGG - Intronic
1150310976 17:64129625-64129647 CAGAAGGCCCCGGCCTGAGGAGG - Intronic
1151580133 17:74972800-74972822 CGACAGGCCCCGCCCCCGCGTGG + Intronic
1151893327 17:76963943-76963965 GCACAGGCCCCTCCCGGAGGTGG + Intergenic
1152077811 17:78169556-78169578 TCACAGGCCCCGCCCCCAGATGG - Intronic
1152656044 17:81519616-81519638 CGACCGGCCCCGCCCAGTGGCGG - Intronic
1161400887 19:4065892-4065914 CTCCAGGCCCCGCCCCCTGGCGG + Intronic
1161404989 19:4086483-4086505 CCACTTGCCCCACCCCGAGGCGG + Intergenic
1161444534 19:4310889-4310911 CATGAGGCCCCGCCCTGGGGTGG + Intronic
1161450602 19:4343521-4343543 CACGCGGCCCCGCCCCGGGGAGG - Exonic
1161550648 19:4910306-4910328 CGACCGGGCCCGCCCCGCGGTGG - Intronic
1161568012 19:5014013-5014035 CCACAGGCCCCGCCCCGGGTAGG - Intronic
1161709672 19:5841056-5841078 CACCACGCCCCGCCCCCAGCTGG + Intergenic
1161721452 19:5904817-5904839 GCACAGGCCCCGCCCCCGGGAGG - Intergenic
1162179257 19:8856109-8856131 CAACAGGCACCACACCGGGGTGG - Exonic
1162927597 19:13938075-13938097 CACCAAGACCCTCCCCGAGGAGG - Intronic
1165494139 19:36141952-36141974 CAAAAGACCCCGCCCCTTGGAGG - Intronic
1165928595 19:39342389-39342411 CCCCTGGCCCCGCCCCGACGGGG - Intronic
1166746160 19:45142827-45142849 CCAGAGGCCCCGCCCCACGGTGG - Intronic
1167643623 19:50694843-50694865 CGGCAGGCCCCGGCCCGCGGTGG - Intronic
1167885044 19:52493314-52493336 CAGCAGGGCCCGGCACGAGGAGG - Intronic
1167890617 19:52536509-52536531 CAGCAGGGCCCACCACGAGGGGG - Intronic
1167903240 19:52637832-52637854 CAGCAGGGCCCGCCACGAGGAGG + Intronic
1167909419 19:52689948-52689970 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167913922 19:52725244-52725266 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167915128 19:52734502-52734524 CAGCAGGCCCCGGCATGAGGAGG + Intronic
1167937938 19:52922887-52922909 CAACAGGGCCCGGCATGAGGAGG + Intergenic
1167946454 19:52992807-52992829 CAGCAGGGCCCGGCACGAGGAGG + Intergenic
1167955098 19:53058024-53058046 CAGCAGGGCCCGGCACGAGGAGG + Intergenic
1167960750 19:53102889-53102911 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167967312 19:53158239-53158261 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167971861 19:53192838-53192860 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1168077517 19:53989667-53989689 CAGCAGGCCCCTCCCCTAGCTGG + Exonic
1168494865 19:56840022-56840044 AAACAAGCCCCGCCCCCAGAGGG + Intronic
927558057 2:24049820-24049842 CCACAGGCCCCGCCTCTGGGGGG - Exonic
934761154 2:96857835-96857857 CACCAGGCCCCGGCCCAAGGAGG - Intronic
948753208 2:240144274-240144296 CACGAGGCCCTCCCCCGAGGTGG - Intronic
1172245890 20:33444509-33444531 TGACAGGCCCCGCCCCCTGGAGG + Intergenic
1173922560 20:46757319-46757341 CAACAGGCCCAGCACGAAGGGGG + Intergenic
1174453824 20:50636075-50636097 CACCAGGCCCAGCCGGGAGGGGG - Intronic
1175427541 20:58878257-58878279 CATCGGGCCCCGGCCCCAGGAGG + Intronic
1176194455 20:63830948-63830970 CGCCACGCCCCGCCCCGCGGGGG - Intronic
1176200958 20:63860357-63860379 TAACAGGCCCCGCCCCTAGTTGG - Intergenic
1178334442 21:31731510-31731532 CCACAGGCCCCGCTCCGCGCAGG + Intronic
1178502806 21:33139871-33139893 CACCCGGCCCACCCCCGAGGAGG + Intergenic
1179647653 21:42785112-42785134 CCGCAGGCCCCGCCCTGTGGTGG + Intergenic
1179937463 21:44614387-44614409 CAAGAGGCACCGTCCCCAGGGGG + Intronic
1180982647 22:19886156-19886178 CAGCAGGCTCAGCCCTGAGGAGG + Intronic
1181026664 22:20131251-20131273 CAAAGGGCCCCGCCTCGGGGAGG + Intronic
1181050126 22:20234436-20234458 CAACAGGCCCCGCTCTGCTGGGG - Intergenic
1182939519 22:34261944-34261966 CAACAGCCCCCTCCCCCATGAGG - Intergenic
1184667231 22:45995443-45995465 AGCCAGGCCCAGCCCCGAGGTGG + Intergenic
1184764389 22:46564032-46564054 CACCCGGCCCAGCCCGGAGGAGG - Intergenic
1184925207 22:47631672-47631694 CAGCTGGCCCCTCCCCAAGGTGG - Intergenic
1185272317 22:49935154-49935176 CACCAGCCCCCGCTCCGAGCAGG - Intergenic
1185313735 22:50170237-50170259 AAACAGCCCCCTCCCCGCGGCGG + Intergenic
950618125 3:14178628-14178650 ACGCCGGCCCCGCCCCGAGGCGG + Exonic
954221672 3:49158663-49158685 AAACAGGCCCTGCCCCGAGTGGG - Intergenic
961613337 3:128159145-128159167 CAACAGGCCTGGGCCCGAGCAGG - Intronic
965619970 3:170633577-170633599 GAACAGGTCCAGCACCGAGGAGG + Intronic
968512705 4:1002602-1002624 CCCCAGGCCCCGCCACGCGGAGG - Intronic
969116092 4:4871664-4871686 CAGCTGGCCCCGCCCCGGGCTGG - Intergenic
971352502 4:25865798-25865820 CATCATGGCCCGCCCCTAGGAGG + Intronic
972277346 4:37569485-37569507 CACCACGCCCGGCCCCGAGGAGG + Intronic
979602976 4:122606516-122606538 CACCAGGCCCCACCCCCAGCTGG - Intergenic
982235680 4:153249294-153249316 CAACAGGCCCCGCCCCGAGGCGG - Intronic
984992694 4:185396573-185396595 CCGCGGGCCCCGCCCCGAGGTGG + Exonic
985615267 5:916335-916357 CAACAGGCCCAGCACCCAGTGGG - Intronic
998385167 5:141753318-141753340 CACCACCCCCCGCCCCGGGGAGG - Intergenic
1001012059 5:168107550-168107572 CATCAGACCCCCCCCCCAGGAGG - Intronic
1001395867 5:171419513-171419535 CGTCCGGCCGCGCCCCGAGGGGG + Intergenic
1001586538 5:172836678-172836700 CCACAGGCCCCACCGTGAGGAGG + Intronic
1006581244 6:35079027-35079049 CACCGGGCCCCTCCCCGAGTGGG + Intronic
1012399223 6:98831198-98831220 CCGCAGTCCGCGCCCCGAGGTGG + Intergenic
1017163775 6:151390278-151390300 CCCCCGGCCCCGCCCCGGGGCGG - Intronic
1018612806 6:165661298-165661320 CAACAGGACGCGGCCCGGGGTGG + Intronic
1021984927 7:26089203-26089225 CAACTGGCCTGGCCCAGAGGAGG - Intergenic
1022090944 7:27108001-27108023 CCCCAGGCCCCGGCCCGTGGTGG + Exonic
1029640164 7:101815659-101815681 CCACAGACCCGGCCCCGAGGGGG - Intergenic
1039918469 8:41876378-41876400 GAACAGGCCCCACCCGGAGAGGG + Intronic
1049035762 8:140074641-140074663 AGACAGTCCCCGCCCTGAGGGGG + Intronic
1049548660 8:143246493-143246515 CAAAAAGCCCCGCCCCGAACCGG - Intergenic
1049802148 8:144522843-144522865 CAGCGAGCCCCGGCCCGAGGCGG - Exonic
1053151900 9:35749032-35749054 CACCAGGCACCGCCCCGGGACGG + Exonic
1053292452 9:36890336-36890358 CAAGAGGTCCTGCCCAGAGGAGG + Intronic
1059405827 9:114098072-114098094 CACCCAGCCCCGCCCCGCGGGGG + Intronic
1060825063 9:126683148-126683170 CTGCAGGCCCGGCCCCGACGCGG + Intronic
1060934590 9:127507837-127507859 CAACAGTCCCCACCCCGGGACGG + Intronic
1061160809 9:128892756-128892778 CAACAGGCCCTGTCCCGGGAGGG - Intronic
1186971724 X:14852453-14852475 CACCACGCCCGGCCCTGAGGAGG + Intronic
1189407122 X:40735363-40735385 CAGCTGGTCCCGCCCGGAGGCGG - Exonic
1189516619 X:41718964-41718986 CCACAGGCCACGCCACCAGGTGG - Intronic
1192783934 X:74319915-74319937 CAACTGACCCCACCCAGAGGCGG - Intergenic