ID: 982235683

View in Genome Browser
Species Human (GRCh38)
Location 4:153249307-153249329
Sequence GGGCCTGTTGCTATGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982235669_982235683 24 Left 982235669 4:153249260-153249282 CCTTCTTTTCTTCCGCCTGAGCG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235680_982235683 -10 Left 982235680 4:153249294-153249316 CCGCCTCGGGGCGGGGCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235668_982235683 27 Left 982235668 4:153249257-153249279 CCGCCTTCTTTTCTTCCGCCTGA 0: 1
1: 0
2: 1
3: 35
4: 478
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235671_982235683 12 Left 982235671 4:153249272-153249294 CCGCCTGAGCGCAGCTCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235672_982235683 9 Left 982235672 4:153249275-153249297 CCTGAGCGCAGCTCGGCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235679_982235683 -9 Left 982235679 4:153249293-153249315 CCCGCCTCGGGGCGGGGCCTGTT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data
982235667_982235683 28 Left 982235667 4:153249256-153249278 CCCGCCTTCTTTTCTTCCGCCTG 0: 1
1: 1
2: 3
3: 51
4: 741
Right 982235683 4:153249307-153249329 GGGCCTGTTGCTATGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982235683 Original CRISPR GGGCCTGTTGCTATGGAGCC CGG Intronic
No off target data available for this crispr