ID: 982242995

View in Genome Browser
Species Human (GRCh38)
Location 4:153319406-153319428
Sequence GATTAAACCATTCCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982242991_982242995 18 Left 982242991 4:153319365-153319387 CCTGTTCAATTTAAGGAACTATT 0: 1
1: 0
2: 1
3: 19
4: 435
Right 982242995 4:153319406-153319428 GATTAAACCATTCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 5
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982242995 Original CRISPR GATTAAACCATTCCAAAGGC AGG Intronic
910340087 1:86176723-86176745 GTTTAAACCATTCCAAAACTAGG + Intergenic
919793882 1:201309517-201309539 GATCAGAACATTCCAGAGGCTGG - Intronic
920234152 1:204491883-204491905 GATAAACACCTTCCAAAGGCTGG - Intronic
1063627231 10:7701572-7701594 GAATAAACCAAACCAAAAGCAGG - Intergenic
1064087101 10:12353365-12353387 AAATAAAGCATTGCAAAGGCTGG + Intronic
1064634554 10:17350564-17350586 GATTTAGGGATTCCAAAGGCAGG + Intronic
1068559423 10:58496598-58496620 GATTAAAACATACCCAAGACTGG - Intergenic
1070745922 10:78933754-78933776 GATTAAACCAAGTCCAAGGCCGG - Intergenic
1071891108 10:90008400-90008422 GCTTACACAATTACAAAGGCTGG + Intergenic
1073680245 10:105695446-105695468 GTTTAGACTGTTCCAAAGGCTGG + Intergenic
1074949500 10:118316851-118316873 GATTACAGTATTCCAAAGGAGGG + Intronic
1074957176 10:118403362-118403384 GTTAAAAACATTTCAAAGGCAGG + Intergenic
1076990196 11:268797-268819 GATTAAACAGTGCCAAGGGCGGG - Intergenic
1077871149 11:6262396-6262418 GATGAAACCATCAGAAAGGCAGG + Intronic
1078205003 11:9221132-9221154 GATTAAAACATTCAATCGGCTGG + Intronic
1084716599 11:70878268-70878290 GACCAAGTCATTCCAAAGGCAGG + Intronic
1085840688 11:80008579-80008601 AATTAAACCATTACAATGGTGGG - Intergenic
1086333219 11:85774784-85774806 CCTTAAACCCTTCCAAAGGCAGG + Intronic
1087129443 11:94655676-94655698 AATAAAACCAGTCCAAAGGAGGG + Intergenic
1096384152 12:51183641-51183663 GAAGAAACCATTCCCCAGGCAGG + Intergenic
1096575632 12:52551063-52551085 GGTTAAACCAGACCAAATGCTGG - Intronic
1097020129 12:56014850-56014872 TATTAAACCTTTCAAAAGCCAGG - Intronic
1106773075 13:32981837-32981859 GATTTAATAATTCCAGAGGCCGG + Intergenic
1107720144 13:43239642-43239664 GCTTATACCATGCCCAAGGCAGG - Intronic
1110332746 13:74291551-74291573 GGTTAATCCAGTCCACAGGCAGG + Intergenic
1113056561 13:106274321-106274343 GATTAAACCCATCCAATGGTCGG + Intergenic
1113453659 13:110431797-110431819 GATTAAAGCATTTCAGATGCAGG - Intronic
1116529912 14:45957351-45957373 GATTCAACCATACCGTAGGCCGG - Intergenic
1119332545 14:73805792-73805814 GATTAAACCAATCTAGAGGCCGG + Intergenic
1119778710 14:77264373-77264395 CATTAGACCTTTCCAAAGCCAGG + Intergenic
1120140140 14:80921279-80921301 GATTAATCCATTCATAAGGGAGG - Intronic
1121872401 14:97420084-97420106 GATGAAACCAATCCAAAGGCGGG - Intergenic
1122608211 14:102962395-102962417 GAATAAACCATCCCAGTGGCTGG + Intronic
1125235176 15:37504759-37504781 GAGCAAACAATTCCAAAAGCAGG + Intergenic
1128100038 15:64990946-64990968 CATTAAACGATTCCAAATGTTGG - Intergenic
1130049164 15:80468680-80468702 GATTAAATGCTTCAAAAGGCAGG - Intronic
1133657149 16:7876671-7876693 GATTAGTACATGCCAAAGGCTGG - Intergenic
1135119358 16:19752175-19752197 AATTAAGCTAATCCAAAGGCAGG - Intronic
1138025480 16:53519119-53519141 AATAAAACCAGTCCAAAGGAAGG + Intergenic
1140311814 16:73856724-73856746 GATTAGAGCTTTCCAAAGGGTGG - Intergenic
1149398367 17:56268533-56268555 GAGCAAACCAATCCCAAGGCTGG + Intronic
1157860466 18:51136413-51136435 CTTTAAAACATTCCAGAGGCTGG + Intergenic
1158291184 18:55945994-55946016 CATTAAACTGTTCCAAAGCCTGG + Intergenic
1165287608 19:34854762-34854784 AATTAAAGCATTCTAAAGGCCGG - Intergenic
927814522 2:26202876-26202898 GATTAAACTATTCCCAAGAGAGG + Intronic
929122341 2:38493945-38493967 GATGAAAGCATTTCCAAGGCAGG + Intergenic
931110866 2:59110171-59110193 GATTATACCATTTCTGAGGCTGG - Intergenic
931536525 2:63283338-63283360 TATAAAAGCATTCCAAAAGCTGG - Intronic
935738443 2:106125564-106125586 GATGAAAACAGTCCAAGGGCTGG + Intronic
936742660 2:115532707-115532729 GATGAAAGCATTCCAAAGTATGG + Intronic
940917814 2:159276432-159276454 GATTTAATCAAGCCAAAGGCTGG + Intronic
944464290 2:199984637-199984659 TACTAACCCATTTCAAAGGCTGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947193195 2:227532134-227532156 GATGAAAGCATTCTAAATGCTGG - Exonic
1172427890 20:34868160-34868182 AATTAAACCATACCTAGGGCCGG - Intronic
1175155820 20:56970912-56970934 GATAAAACCTTTCCAATGTCAGG - Intergenic
1181838412 22:25630555-25630577 TATCAAACCCTTCCAATGGCTGG - Intronic
951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG + Intergenic
956485086 3:69713862-69713884 GATTAAACAACTCCCAAGGGAGG - Intergenic
957036188 3:75295204-75295226 GATTAAACAATTACAAGGGAGGG + Intergenic
959201059 3:103248250-103248272 GATTTAAGCATCCCAAGGGCAGG - Intergenic
959262059 3:104095218-104095240 GATTAAACCTTATAAAAGGCTGG + Intergenic
960411947 3:117337843-117337865 CATTAAACCATTCCAAGGAAGGG + Intergenic
961079930 3:124017650-124017672 GATTAAACAATTACAAGGGAGGG + Intergenic
961303203 3:125935474-125935496 GATTAAACAATTACAAGGGAGGG - Intronic
966305740 3:178532632-178532654 CATTAAACCATTTCACTGGCGGG + Intronic
972282922 4:37620404-37620426 GATTCTACCATCTCAAAGGCTGG - Intronic
974861986 4:67533382-67533404 GATAAAAACATTCCTAAGACTGG - Intronic
978413721 4:108453808-108453830 GATAAAACAATGCTAAAGGCAGG + Intergenic
981254508 4:142645686-142645708 GATATAACCGTTCCAATGGCAGG - Intronic
981559532 4:146032253-146032275 GATTACAACATACCACAGGCAGG - Intergenic
982242995 4:153319406-153319428 GATTAAACCATTCCAAAGGCAGG + Intronic
982407687 4:155038594-155038616 CATTTAGCCATTCCAAAAGCAGG + Intergenic
985962596 5:3314021-3314043 GATGAGACCATTGCAAACGCAGG + Intergenic
989711684 5:44405539-44405561 GATAAAGCCATTACAATGGCCGG + Intergenic
990981249 5:61604348-61604370 GATTAAAACATTGCAAAGGCCGG - Intergenic
992632725 5:78697565-78697587 AATAAAACAATACCAAAGGCTGG - Intronic
992757650 5:79923758-79923780 CATTAATCCATTCAAAAGGGTGG + Intergenic
993134595 5:83943233-83943255 AATTAAATCATTGAAAAGGCAGG + Exonic
994417010 5:99484821-99484843 GATAAAAACATACCAGAGGCTGG - Intergenic
994462965 5:100090353-100090375 GATAAAAACATACCAGAGGCTGG + Intergenic
994525028 5:100895720-100895742 GATAAAATCATTCGAAAGGCTGG - Exonic
994583559 5:101678083-101678105 GATTAAACCAGTCCTGAGACAGG + Intergenic
994699800 5:103119951-103119973 AATTAAACCCTTCCTTAGGCCGG + Intronic
994714654 5:103306973-103306995 GATAAAACCATTGCAAGGCCGGG - Intergenic
995401410 5:111746457-111746479 GATTTAACTTTTCCAAAGCCTGG - Intronic
1001903586 5:175452413-175452435 AATTAAATCATTGCAGAGGCAGG - Intergenic
1002670701 5:180864119-180864141 ACTTAAACCACTCCAAAGGGAGG - Intergenic
1003019580 6:2497826-2497848 GATCAAACCATTGCAGAGACAGG - Intergenic
1003958601 6:11189239-11189261 GATTAAAACATTCTACTGGCTGG - Intronic
1005218998 6:23564509-23564531 GATTCAACCATTACAAAAGTGGG - Intergenic
1006741133 6:36309779-36309801 TCTTAAGCAATTCCAAAGGCTGG + Intergenic
1007230580 6:40345056-40345078 GATGGAACCAATCCAAAGGCTGG + Intergenic
1007600636 6:43078660-43078682 GATTAGACCATTTTAAAGTCTGG + Intronic
1011765722 6:90617363-90617385 GTTTAAACCAAACCCAAGGCAGG - Intergenic
1011847295 6:91582008-91582030 GATTTAACTATTCAAAAGTCGGG + Intergenic
1013628022 6:111956943-111956965 GATTAAAGAATTGCAAAGCCAGG + Intergenic
1015574931 6:134661016-134661038 GCGTGAACCATTTCAAAGGCTGG + Intergenic
1017316320 6:153035683-153035705 AATTCAACCATTCCAAATCCAGG - Intronic
1018489207 6:164274522-164274544 GATTTAACCATGCCAGGGGCAGG + Intergenic
1020542977 7:9484819-9484841 AATTAAAACATTTCAATGGCTGG - Intergenic
1023669185 7:42558213-42558235 GAGTAAGCCATGCCAATGGCTGG - Intergenic
1026442597 7:70457269-70457291 AATTAAACCATTCCACGGGGTGG - Intronic
1028512352 7:91639225-91639247 GAATGATCCATTCCAGAGGCTGG + Intergenic
1030248875 7:107419023-107419045 GATTAAAGTATTCCAAATACAGG - Intronic
1030432106 7:109462984-109463006 GATTAGACTATTGCAAAGTCAGG + Intergenic
1030555434 7:111018903-111018925 GATTGAACCATTGCAAATGTAGG - Intronic
1031464137 7:122087475-122087497 GAGTAAACATTTCCAAAGGGGGG + Intronic
1031871746 7:127095266-127095288 GACAAAACCATTCCAAACCCTGG + Intronic
1032640806 7:133765289-133765311 GATAAATTCAATCCAAAGGCAGG - Intronic
1032728016 7:134610081-134610103 GTAAAAACCATACCAAAGGCTGG + Intergenic
1036968794 8:13330749-13330771 GATTAAAAAATTCAAAAGGAAGG - Intronic
1040618621 8:49064505-49064527 GATTCAAGCAATGCAAAGGCAGG + Intronic
1042201675 8:66284882-66284904 AATCAGACAATTCCAAAGGCAGG - Intergenic
1042491187 8:69400025-69400047 GAATATACAATTCCAAAGGAGGG - Intergenic
1042527319 8:69777038-69777060 GATTCAACCATTCCACACCCAGG + Intronic
1043805609 8:84669092-84669114 TATTACACCATTTCAAAGGGTGG - Intronic
1044315554 8:90746544-90746566 GAGTAAACAAATCCAAAAGCTGG - Intronic
1046117864 8:109805656-109805678 CATTAAACCATTCACAAGGGCGG + Intergenic
1047405018 8:124578125-124578147 GATTGAACCATTCTGGAGGCAGG + Intronic
1051342349 9:16123223-16123245 GCTTAAACCATTCCAAATCAAGG + Intergenic
1055033977 9:71798283-71798305 AATTAAAACATTTAAAAGGCTGG - Intronic
1186049208 X:5571908-5571930 GATAAATACATACCAAAGGCTGG - Intergenic
1186079107 X:5911384-5911406 GTTTTAACCTTTCCAAAAGCAGG + Intronic
1187373497 X:18729809-18729831 GCTTAAGCCATGCCAAAGGTAGG + Intronic
1188297665 X:28469748-28469770 CATTAAATCATTGCAAAGGTGGG - Intergenic
1193706084 X:84822229-84822251 GACTAAAACATTGCAAAAGCTGG - Intergenic
1193998941 X:88402664-88402686 GAACAAGCTATTCCAAAGGCTGG - Intergenic
1194567687 X:95513188-95513210 CATTAAACACTTCCAAAGACTGG + Intergenic
1194876346 X:99193286-99193308 GGTTAAACCATAACAAAGACTGG + Intergenic
1194895318 X:99432768-99432790 GATTCAACCATTCCGGAGTCTGG - Intergenic
1195387009 X:104323151-104323173 GAATAAACCATCCCAGAGGATGG + Intergenic
1196848623 X:119916810-119916832 GTTTAAAACTTTCCAAGGGCAGG + Intronic
1197179245 X:123516711-123516733 GATTAATCCATTCATAAGGGTGG + Intergenic