ID: 982243490

View in Genome Browser
Species Human (GRCh38)
Location 4:153324783-153324805
Sequence CACCTTGAGAAGCCTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982243490_982243492 10 Left 982243490 4:153324783-153324805 CCTAGATCAGGCTTCTCAAGGTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 982243492 4:153324816-153324838 TCCACTGAAGGTATGATCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
982243490_982243491 -2 Left 982243490 4:153324783-153324805 CCTAGATCAGGCTTCTCAAGGTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 982243491 4:153324804-153324826 TGTGATGCATGTTCCACTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 109
982243490_982243494 17 Left 982243490 4:153324783-153324805 CCTAGATCAGGCTTCTCAAGGTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 982243494 4:153324823-153324845 AAGGTATGATCCGTGGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 51
982243490_982243496 28 Left 982243490 4:153324783-153324805 CCTAGATCAGGCTTCTCAAGGTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 982243496 4:153324834-153324856 CGTGGCCATAGGCAGTACACTGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982243490 Original CRISPR CACCTTGAGAAGCCTGATCT AGG (reversed) Intronic
900391261 1:2434959-2434981 CCCCCTGAGAAGCCAGCTCTGGG - Intronic
900795791 1:4707538-4707560 CACCTTGAAAACCCTGAGCAGGG - Intronic
901217593 1:7563348-7563370 CACCTCAAGAAGCCTGGTTTGGG + Intronic
901527858 1:9835480-9835502 CATCTCCAGATGCCTGATCTGGG + Intergenic
901547945 1:9973344-9973366 CACTTTGGGAAGCCTGAGGTTGG - Intronic
902606391 1:17571733-17571755 CACCTTGACCAGGCTGGTCTTGG + Intronic
903920279 1:26795130-26795152 ACCCTAGAGAAGCCCGATCTTGG + Exonic
906155386 1:43611131-43611153 CACCTGAAGAAGCCTCATGTTGG - Intronic
906569476 1:46824263-46824285 CACCTTAACAAGCCTTACCTGGG - Intergenic
906962776 1:50428624-50428646 CACAGTGAGAAGTCTAATCTTGG + Intergenic
907280577 1:53344427-53344449 CAGCTTCAGCAGCCTCATCTAGG + Intergenic
909565420 1:77048304-77048326 CAGCTTCAGGAGCCTAATCTGGG - Intronic
911460353 1:98181682-98181704 CTCCCAGAAAAGCCTGATCTAGG - Intergenic
915299393 1:154943440-154943462 CACCTTAAGAAGCCTAAAGTTGG - Intergenic
916062608 1:161110660-161110682 AACCTGGAAAAGCATGATCTGGG + Intronic
917717128 1:177749575-177749597 CCCCTTGAGAAGACTGCTGTTGG - Intergenic
917902386 1:179555554-179555576 AACCTTGAGAAGACTAATTTGGG + Intronic
920665039 1:207957222-207957244 CAACTTGCTAAGGCTGATCTGGG - Intergenic
921107835 1:212000820-212000842 GACCTTAAGAAGCCTAATGTAGG - Intronic
1063242752 10:4188197-4188219 CACCTTGAGAAACAGGCTCTGGG + Intergenic
1063350392 10:5348837-5348859 CACTTTGAGTAGCCAGATCCTGG + Intergenic
1065361233 10:24890885-24890907 CTCCCTGAGAAGCCTCTTCTAGG - Intronic
1067793296 10:49303476-49303498 CACCTGGAGAAAGCTGATCTGGG - Intronic
1068681658 10:59826545-59826567 GGCCTTGAGAAGCCTGGTCCAGG - Intronic
1069408631 10:68129059-68129081 CACTTTGAGTAGCCTGCTCTAGG - Intronic
1071604932 10:86979473-86979495 CACTTTGGGAAGCCTGAAGTGGG + Intronic
1072010379 10:91298325-91298347 GACCTTGGGAAGCCCGACCTGGG + Intergenic
1072804056 10:98413164-98413186 CACATTGAGCAACCTCATCTTGG + Intronic
1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG + Exonic
1077305859 11:1868474-1868496 CACCCTGAGCAGCCTGGTCCAGG + Intronic
1082696793 11:56376932-56376954 CAGCTTCAGAATCCTGAACTGGG - Intergenic
1085777677 11:79381200-79381222 CCACTTGAGAAGCCTGATAATGG - Intronic
1085870281 11:80341408-80341430 CAGTTTGAGAAGCCAGAGCTGGG + Intergenic
1087647156 11:100821451-100821473 CAGCCTGAGGAGCCTGATATTGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088738074 11:112745072-112745094 CAGCTTGAGGAGCCAGATGTGGG + Intergenic
1091244810 11:134082828-134082850 CAGGTTGAGAAGCCTGCTTTAGG + Intronic
1091725752 12:2845493-2845515 CCCCTTTCCAAGCCTGATCTTGG - Intronic
1091841774 12:3626729-3626751 GGCCTTGAGAAGCCTGCACTGGG + Intronic
1097288850 12:57897180-57897202 CACCCTTAGAAGTCTGCTCTTGG - Intergenic
1098119455 12:67220741-67220763 CACCTGGAGAACACTGAACTGGG - Intergenic
1098256236 12:68618493-68618515 TACCTTGAAAATACTGATCTAGG - Intronic
1100362203 12:93889347-93889369 CACCTGGAGGAACCTGAGCTGGG - Intronic
1105538983 13:21298212-21298234 CACCGTGAGAACCCTGTCCTGGG - Intergenic
1105922987 13:24982645-24982667 CACCTGGAGAAGGCTGCTCTGGG + Intergenic
1107106760 13:36651719-36651741 ACCCCTGAGAAGCCTGATGTTGG - Intergenic
1110762464 13:79245610-79245632 AACGTTGAGAACACTGATCTAGG + Intergenic
1113520498 13:110937192-110937214 GACCCTGAGAAGCCTCAGCTAGG + Intergenic
1115364628 14:32544086-32544108 ATCCTGGAGAAGCCAGATCTGGG + Intronic
1115620970 14:35139882-35139904 TACCTTCAGAAGCCAGATCCTGG + Intronic
1120968102 14:90185130-90185152 CATCTTTAGAAATCTGATCTCGG + Exonic
1121705416 14:95989617-95989639 CACATTCAGATGTCTGATCTTGG - Intergenic
1122094396 14:99360856-99360878 CACCTCCAGAGGCCTGATCTTGG + Intergenic
1202881039 14_KI270722v1_random:60523-60545 CCCTTTGGGAAGCCTGACCTGGG + Intergenic
1123685802 15:22796221-22796243 CTCCTAGAAAAGCCTTATCTGGG - Intronic
1125832053 15:42723953-42723975 CACTTTGAGAGGCCTGAGGTCGG - Exonic
1126566782 15:50109030-50109052 CAGCTTGGGAAGGCAGATCTAGG - Intronic
1129360506 15:75021154-75021176 ACCCTTGGGAAGCCTGATCCCGG + Exonic
1130934108 15:88454562-88454584 CCCCTTGGAAAGCCTGAACTGGG - Intergenic
1134104411 16:11475777-11475799 CACCTTGAGCTGCCAGAGCTTGG + Intronic
1134246373 16:12543311-12543333 CACCTTGATTAGCCAAATCTGGG + Intronic
1135182367 16:20286961-20286983 CACTTTGAGAAGCATGTCCTTGG + Intergenic
1139326914 16:66159921-66159943 CACCATGAGAAGACTGAGCCTGG - Intergenic
1140045297 16:71436668-71436690 TTGCTTGAGAAGGCTGATCTTGG + Intergenic
1144797382 17:17901444-17901466 GACTTTGAGGAGCCTGATCATGG - Intronic
1150605375 17:66686282-66686304 TAGCTTGAGAAACCTGATATGGG - Intronic
1152563554 17:81090307-81090329 CACCGTGAGAAGGTTGATGTCGG - Intronic
1152708657 17:81859287-81859309 CACCTTGGCCAACCTGATCTCGG + Exonic
1153545325 18:6199216-6199238 CACCTTAAGAAGCCCCATGTAGG - Intronic
1155009886 18:21766790-21766812 CACTTTGGGAAGCCTGAGGTGGG + Intronic
1155118681 18:22796639-22796661 AACCATGAGAAGGCTGCTCTTGG - Intergenic
1162172629 19:8803415-8803437 CCTCTTTAAAAGCCTGATCTTGG - Intergenic
1163103984 19:15113148-15113170 CACTTTGAGAGGCCTGAAATGGG - Intronic
1163615718 19:18326938-18326960 CACCTAGATAAGCCTCTTCTAGG - Intergenic
1168486585 19:56767765-56767787 CGACTTGAGAAGTCTGATCTGGG - Intergenic
1202656645 1_KI270708v1_random:29628-29650 CCCTTTGGGAAGCCTGACCTGGG + Intergenic
926359740 2:12075056-12075078 CAACTTGAGAAACTTGCTCTTGG - Intergenic
931192872 2:60022708-60022730 CACCTTGAGGGTCCTGAGCTTGG - Intergenic
935496288 2:103785657-103785679 GACCTTGATTAGCCTGATCTGGG - Intergenic
942614361 2:177774913-177774935 CACCTTGAGATGGATTATCTTGG + Intronic
945484193 2:210375552-210375574 CACTTTGAGAAGCCGGAGGTGGG - Intergenic
948378387 2:237537073-237537095 CACCTTGAGGGGCTGGATCTGGG + Intronic
1172611608 20:36256562-36256584 GGCCTTAAGAAGCCTGCTCTGGG - Exonic
1174507759 20:51027619-51027641 CACCTTGGGATTCCTGGTCTGGG + Intergenic
1175899093 20:62353051-62353073 GACCTTCAGAAGCCTGGTCACGG + Intronic
1177783121 21:25640452-25640474 CACTTAGAGAAGTCTGGTCTGGG + Intronic
1178388618 21:32180059-32180081 CACCTTGATAAGCCAGTTCTGGG - Intergenic
1180225355 21:46388808-46388830 CACCCTGAGGAGCCGGATCGGGG + Exonic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1182286282 22:29249951-29249973 CACCTTGCCCAGCCAGATCTTGG - Intronic
1183316642 22:37140803-37140825 AACGGTGAGAAGCCTGAACTGGG + Intronic
950252073 3:11474351-11474373 CACCTTGAGAGGCCCGAGGTAGG + Intronic
954802844 3:53197059-53197081 CCACTTAAGAAGCCTGATTTAGG - Intergenic
955758239 3:62249259-62249281 CACCTTGAGAGGCCTGAATTTGG + Intronic
956205856 3:66754029-66754051 AACCTTGAGAACCATGATCCTGG - Intergenic
958660891 3:97065667-97065689 CACTTTGGGAAGTTTGATCTTGG - Intronic
960297264 3:115959496-115959518 CACTTTTAAAAGCCTGATTTAGG + Intronic
960362819 3:116734944-116734966 GAACTTGAGAGACCTGATCTAGG + Intronic
960563932 3:119114439-119114461 GACCTTGAGAAGGATGATTTAGG - Intronic
961074687 3:123971225-123971247 CAGTTAGAGAAGCCTCATCTAGG - Intronic
961308995 3:125981258-125981280 CAGTTAGAGAAGCCTCATCTAGG + Intronic
962942053 3:140134014-140134036 GACCTTGAGAAGTCAGAGCTTGG + Intronic
966258428 3:177946315-177946337 CACACTGAGAAGTGTGATCTGGG - Intergenic
968229928 3:196999551-196999573 CACCTTGGGAGGCAGGATCTAGG + Intronic
969490393 4:7496301-7496323 CAGCTTGAGCAGCCGGACCTTGG - Intronic
969896413 4:10309229-10309251 TGCCTTGAGAATCCTGACCTAGG + Intergenic
970171957 4:13299214-13299236 CAGCTTGAAATCCCTGATCTAGG - Intergenic
971326648 4:25650037-25650059 CACTTTGAGAGGCCTGAGGTGGG - Intergenic
977071332 4:92392252-92392274 CCCCTTGAGAAGCATTTTCTTGG + Intronic
979314247 4:119242040-119242062 CACTTTGAGAAGTTTTATCTTGG + Intronic
982243490 4:153324783-153324805 CACCTTGAGAAGCCTGATCTAGG - Intronic
983971696 4:173883151-173883173 CACCTAGAAAGGCCTTATCTGGG + Intergenic
990020088 5:51115938-51115960 TCCCTTGAGCAGCCTGACCTTGG + Intergenic
991280759 5:64910605-64910627 CAGCTGGAGAAGCTTGAACTGGG - Intronic
993565064 5:89463816-89463838 CCCATTGAGAAGGCTGACCTTGG + Intergenic
994638762 5:102378377-102378399 CACTTTGGGAAGCCTGAGTTGGG - Intronic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
996991028 5:129631997-129632019 CTCTTTAAGAGGCCTGATCTGGG + Intronic
997907062 5:137828460-137828482 CACCTTGAAAAGAATGAGCTTGG - Intergenic
998102677 5:139447310-139447332 CACCTTGAGAAGTCTGAATCAGG + Intergenic
999394893 5:151221106-151221128 CACCCTGAGAGGCCTGGCCTGGG - Intronic
999499920 5:152136719-152136741 CTCCCTGGGAAGCCTGATCTTGG + Intergenic
999704146 5:154256070-154256092 TACCTTGAGAAGGAAGATCTGGG - Intronic
1002126856 5:177052051-177052073 CACCTTGGGAAGGCTGAGGTGGG + Intronic
1002306961 5:178289236-178289258 TTCCTTGAGAAGGCTGATTTTGG + Intronic
1003399903 6:5782739-5782761 CACCTGGAGAAGGCTGCTCTGGG + Intergenic
1004745617 6:18506464-18506486 CATCCTGAGAAGCCTGAGTTAGG - Intergenic
1007906658 6:45468058-45468080 CAGCCTGAGAAGCCTGTACTTGG - Intronic
1008521370 6:52364507-52364529 CCCCTTCAAAAGCCTGCTCTTGG + Intronic
1010443953 6:75930688-75930710 CACTTTGAGAACCCTGCTCTAGG - Intronic
1012968310 6:105699454-105699476 CATCTTTAGATGACTGATCTGGG - Intergenic
1017490646 6:154941729-154941751 CACCTTTAAAAGCCTTCTCTTGG + Intronic
1022227593 7:28379737-28379759 AACATTGAGAATACTGATCTAGG + Intronic
1023287546 7:38634548-38634570 CTCCTTAAGAACCCTGAGCTAGG + Intergenic
1026518637 7:71095185-71095207 CATCTTGAGAGGGCTGAGCTAGG + Intergenic
1027218051 7:76196870-76196892 CACCAGGAGAAGCCAGATCCAGG - Intergenic
1030080177 7:105770839-105770861 CACTTTGAGAAGCAAGAGCTTGG - Intronic
1031183806 7:118450273-118450295 CACCATTAGAAGCCAGATGTCGG - Intergenic
1031769529 7:125826156-125826178 CACTTTGAGAAAAGTGATCTAGG - Intergenic
1035187099 7:157134865-157134887 CACGTTGATCAGGCTGATCTTGG - Intergenic
1035778413 8:2208293-2208315 CTCCTTGAGAAACCAGAACTTGG - Intergenic
1037656303 8:20887096-20887118 CACCTTGAGAAACCAGAGCCAGG - Intergenic
1038262465 8:26008362-26008384 CACTGTGAGAAGCCTCAGCTGGG + Intronic
1044263442 8:90155356-90155378 GAGCGTGAGAAGCCTGCTCTGGG + Intergenic
1046725743 8:117671748-117671770 CACTTTTAGAAGGCTAATCTGGG - Intergenic
1046771621 8:118122375-118122397 CACTTTGACTAGTCTGATCTTGG + Intergenic
1047610746 8:126518525-126518547 CACCTGGAGAAGACTGAGGTTGG + Intergenic
1048617777 8:136097338-136097360 TACCTTAAGAAGCCTGATAGAGG - Intergenic
1049478082 8:142806125-142806147 CACCAGGAGAAGCCTCATCGCGG + Intergenic
1057014542 9:91639915-91639937 CACATCTAGAAGCCAGATCTTGG + Intronic
1057635817 9:96765386-96765408 CACCTTGTTGAGCCTCATCTGGG - Intronic
1060018798 9:120110727-120110749 CACCATGAGGAGCCTGGTGTTGG - Intergenic
1060783303 9:126429868-126429890 GACCCTGAGAACCCTGAGCTGGG + Intronic
1185887159 X:3793059-3793081 CACCATGGGAAGACTGTTCTGGG + Intergenic
1188208985 X:27395654-27395676 AATCTTGAGAAGACTGATCAAGG + Intergenic
1189905130 X:45750994-45751016 CACCTTTAGAAGCTTGTTTTAGG - Intergenic
1190582681 X:51903781-51903803 CACCGGGAGAAGCCTGAGGTAGG - Intergenic
1190929170 X:54933816-54933838 CACCGGGAGAAGCCTGAGGTAGG - Exonic
1199720011 X:150536724-150536746 CACCCTGGGAAGCCTGGACTGGG - Intergenic
1200887020 Y:8280563-8280585 TATCTGCAGAAGCCTGATCTCGG - Intergenic