ID: 982247942

View in Genome Browser
Species Human (GRCh38)
Location 4:153373351-153373373
Sequence GGGGCTGATTCAGCATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982247940_982247942 -4 Left 982247940 4:153373332-153373354 CCTAAAACTAGGCATAATGGGGG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 223
982247934_982247942 21 Left 982247934 4:153373307-153373329 CCTTCTTACCAGACAATCATTTC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 223
982247935_982247942 13 Left 982247935 4:153373315-153373337 CCAGACAATCATTTCTTCCTAAA 0: 1
1: 0
2: 6
3: 32
4: 304
Right 982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982247942 Original CRISPR GGGGCTGATTCAGCATTTCT TGG Intronic
901829758 1:11885239-11885261 GGGGCTGCATCAGCTTTGCTTGG - Intergenic
902714334 1:18262062-18262084 GAGTCTGATTCAGCAGGTCTGGG + Intronic
905521717 1:38605507-38605529 TGGGGTCATTCAGCATTTCACGG + Intergenic
905537144 1:38731154-38731176 GGCTCTGATTCAGCAGGTCTGGG - Intergenic
906829989 1:49020873-49020895 GAGGCTGATTCAGTCTTTCCAGG - Intronic
907311001 1:53538958-53538980 GGGGCTGAGTCAGCTTCTCTTGG + Intronic
917857034 1:179109229-179109251 GGGGCTGATTCTCCATTTCTCGG + Exonic
919705508 1:200671303-200671325 GGGGCAGATTCAGGTTTTATGGG - Intergenic
919744520 1:201000245-201000267 GGGGCTGCCTCAGTATTGCTTGG - Intronic
920288205 1:204897068-204897090 GGTTCTGAATCAGCATGTCTGGG - Intronic
923123725 1:231017517-231017539 GGGGCTGATTCAGCAAGGCTGGG + Intergenic
923145064 1:231191982-231192004 GGAGCTGATGCAGCTTTCCTGGG + Intronic
924384152 1:243487330-243487352 GGGGCTGAGGCAGCCTTTCCTGG - Intronic
924473224 1:244361771-244361793 AAGACTGATTCAGAATTTCTAGG + Intronic
1063111710 10:3043946-3043968 GTGTGTGATTCAGCATTTCTTGG + Intergenic
1066502278 10:36005901-36005923 GGGGCTGGTGAAGCATTTCCTGG + Intergenic
1067730207 10:48805267-48805289 TGGGCAGCTTCAGCATTCCTGGG - Exonic
1068555706 10:58456365-58456387 CCTGCTGATTCAGCATTTTTAGG - Intergenic
1073020401 10:100438678-100438700 GGGGCTGATTGAGATTTTATGGG + Intergenic
1074630576 10:115250571-115250593 TGGGCTGAAGCAGCATTCCTAGG + Intronic
1075298439 10:121298688-121298710 ATGGTTGATTCAGTATTTCTGGG + Intergenic
1076615659 10:131752497-131752519 GGGGGTGAGTCAGCTTTCCTGGG + Intergenic
1076631748 10:131855976-131855998 AGGGCTGACACAGCATTTCTGGG + Intergenic
1078388135 11:10911065-10911087 GATTCTGATTCAGCATATCTGGG + Intergenic
1078476613 11:11635611-11635633 GGGGATGATAAAGCATTACTTGG + Intergenic
1080381921 11:31780728-31780750 TGGACTGGCTCAGCATTTCTTGG - Intronic
1082092069 11:48098238-48098260 GGTGCTGAATCAGCATTTAATGG + Intronic
1086916195 11:92532746-92532768 GGAGCTGCTTAAGCATTTCAAGG - Intronic
1087054672 11:93922034-93922056 GAGGCTGATTCTGCAATTGTTGG - Intergenic
1088624997 11:111723730-111723752 GGGGCTGAAGCTGCATCTCTTGG - Exonic
1088808194 11:113370615-113370637 GGGGCTGGATCAGGCTTTCTTGG + Intronic
1088855070 11:113742222-113742244 GGAGGTGAATCAACATTTCTAGG + Intronic
1090701337 11:129298643-129298665 GGCCCCGCTTCAGCATTTCTAGG - Intergenic
1092197406 12:6557624-6557646 GTGGCTGTTTCAGAATTTCCTGG + Exonic
1092763093 12:11827243-11827265 GCTGCTGATTCAGCATTTCGCGG - Intronic
1094411364 12:30170923-30170945 GGGTCTGATTATTCATTTCTGGG + Intergenic
1096757046 12:53808405-53808427 GGGGCTGATTCATATTTTGTAGG + Intergenic
1097238000 12:57552751-57552773 GAGGCTGCTTCAGGATGTCTAGG + Intronic
1099016028 12:77345288-77345310 GTGGCTGGGTCAGCATTTGTGGG + Intergenic
1100132356 12:91511980-91512002 GGGGCTGCTTCAGAACTGCTAGG + Intergenic
1102999710 12:117375969-117375991 GGCGCTCAATCAGCATTTGTGGG - Intronic
1104440584 12:128790269-128790291 GGGGCTCATCCTGCGTTTCTGGG + Intergenic
1106689959 13:32104387-32104409 GTGGCGGATGCAGCAGTTCTGGG - Intronic
1110290971 13:73806204-73806226 GGGGCTGAGGCAGAATTGCTTGG - Intronic
1111697695 13:91645821-91645843 GACTCTGATTCAGCATATCTGGG + Intronic
1112437708 13:99403481-99403503 GGGGCAGACTCAGCAGGTCTGGG + Intergenic
1115268153 14:31522995-31523017 GGGGGATATTCAGCATTTGTTGG - Intronic
1115358952 14:32480004-32480026 GGGGCTGATTTAGGATTTCCTGG + Intronic
1117089914 14:52239205-52239227 GATTCTGATTCAGCAGTTCTGGG - Intergenic
1118386449 14:65259302-65259324 GTGTCTGATTCAGCAAGTCTAGG - Intergenic
1120387025 14:83859169-83859191 GTGGCTGAAGCAGCATGTCTTGG - Intergenic
1121274038 14:92655935-92655957 AGGGCTGAGTCTGCAGTTCTGGG + Intronic
1122197321 14:100098390-100098412 GAGGGCGATGCAGCATTTCTGGG + Intronic
1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG + Intergenic
1124610759 15:31206854-31206876 CGGGCCTATTCAGCATGTCTGGG + Intergenic
1126678575 15:51182917-51182939 GGAGCTGAGTGAGCATTTTTGGG - Intergenic
1126771241 15:52058168-52058190 AGGGCTCAGTTAGCATTTCTAGG - Intronic
1127616910 15:60695180-60695202 GGGGCTGATGCAACATGTATGGG - Intronic
1129956263 15:79639537-79639559 GAGTCTGATTCAGCAGGTCTGGG - Intergenic
1130513537 15:84608216-84608238 GTGTCTGATTCAGGAGTTCTAGG - Intronic
1131013894 15:89041810-89041832 GGGGCTGAGACAGCATTGCTAGG + Intergenic
1132494359 16:254075-254097 GGAGCTCATTGAGCATTTCCTGG + Intronic
1133202888 16:4215249-4215271 GGGGCTGAGGCAGCCATTCTTGG + Intronic
1134067131 16:11235849-11235871 GAGGCTGATGCAGGATTACTTGG + Intergenic
1134762954 16:16730237-16730259 GGGACTGACTCAGCATCTCACGG - Intergenic
1134983098 16:18628912-18628934 GGGACTGACTCAGCATCTCACGG + Intergenic
1135271682 16:21075019-21075041 GGTTCTGATTCAGCAGGTCTGGG - Intronic
1135663659 16:24317757-24317779 GGATCTGATTCAGCAGGTCTGGG - Intronic
1136135224 16:28252430-28252452 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1136142119 16:28294251-28294273 GGATCTGATTCAGGATTTCAGGG - Intronic
1137855470 16:51790399-51790421 GGGTCTGATTCAGTAGATCTGGG - Intergenic
1139521262 16:67483880-67483902 GGGGTTGAGTAAGCATCTCTGGG - Intergenic
1140039850 16:71399083-71399105 TGGACTGAATCAGGATTTCTAGG - Intergenic
1140244251 16:73233784-73233806 GGGGCTCTTTAAGGATTTCTGGG + Intergenic
1140525256 16:75617698-75617720 GATTCTGATTCAGCATATCTAGG - Intronic
1141238656 16:82244097-82244119 GATTCTGATTCAGCAATTCTGGG + Intergenic
1141299599 16:82801666-82801688 GAGGCTGACCCAGCATTTCCAGG - Intronic
1141534906 16:84672593-84672615 GTGGCTGATTCAGCTGGTCTGGG - Intergenic
1143421199 17:6793955-6793977 GACGCTGACTCAGCCTTTCTAGG + Intronic
1145095432 17:20021463-20021485 GAGGCTCATTCAGCATTACTGGG - Intronic
1145286142 17:21507141-21507163 AGGGTTGATTCAGCACCTCTGGG - Intergenic
1146466785 17:33092514-33092536 GTGACTGAATCAGAATTTCTGGG - Intronic
1147497716 17:40933560-40933582 TGGGCTTATTTAGCTTTTCTGGG + Intronic
1148242637 17:46010612-46010634 GGGGGTGTCCCAGCATTTCTGGG + Intronic
1150286431 17:63956934-63956956 GTGTCTGATTCAGCAGCTCTGGG - Intronic
1151522751 17:74642084-74642106 GGGGCTGTGTCAGCAATTTTTGG - Intergenic
1154104674 18:11511261-11511283 GGGAGTCATTCAGCCTTTCTGGG + Intergenic
1156178179 18:34572200-34572222 GGGCCTGAATCAGAATCTCTAGG - Intronic
1156339093 18:36195444-36195466 GGGGCTTATTCAGCTTTTTGTGG - Intronic
1156380779 18:36559163-36559185 GGGGCTTATTCAGGTTTTCAGGG + Intronic
1158541494 18:58359778-58359800 GGTGCTGATTCAGTAGGTCTGGG - Intronic
1159150451 18:64516814-64516836 GGTGCTTATTCAGCCTTTTTTGG + Intergenic
1164199223 19:23003015-23003037 CCGGCTGACTCACCATTTCTAGG + Exonic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1167356016 19:49004585-49004607 GGGGCTTATTAAGCAGTTCCAGG + Intronic
925668783 2:6290069-6290091 AAGGCTGATACAGCATTTGTAGG - Intergenic
925702985 2:6657598-6657620 GGGGCTCAGTCCCCATTTCTAGG + Intergenic
926720955 2:15959820-15959842 GGTGCTGATCCAGCACTCCTGGG + Intergenic
927198432 2:20563868-20563890 GGGTCTGATTCAGCAGGTCTGGG - Intronic
928118288 2:28563688-28563710 GGGCCTGATTCTGCTTTTCATGG - Intronic
928396110 2:30944461-30944483 GTGGCTGACTCAACATCTCTGGG + Intronic
930153270 2:48079523-48079545 GATGCTGATTCAGTAGTTCTGGG + Intergenic
930179605 2:48339671-48339693 GTAACTGATTCAGCATTTTTTGG + Intronic
931276090 2:60745173-60745195 GAGGCTGAGACAGCTTTTCTGGG - Intergenic
931439324 2:62276859-62276881 GGGGCAGATCCCTCATTTCTTGG + Intergenic
933325188 2:80826758-80826780 GGGCGTGATTCAGCCTGTCTTGG + Intergenic
933331484 2:80897715-80897737 GGAGATTATTTAGCATTTCTAGG + Intergenic
933396051 2:81732686-81732708 GTTTCTGATTCAGGATTTCTGGG - Intergenic
933560443 2:83879296-83879318 TAGCCTGACTCAGCATTTCTGGG - Intergenic
934113189 2:88761005-88761027 ATGGCTGAGTCAGCATCTCTTGG - Intergenic
934677253 2:96258343-96258365 TGGGCTGAGTCAGCTTTGCTGGG - Intronic
937517505 2:122671918-122671940 GGGGTTTATACAGCAATTCTTGG + Intergenic
938109118 2:128552469-128552491 GGTGCTGATTCAGCAGGCCTGGG - Intergenic
942523758 2:176831274-176831296 TAGGCTGATGCAGCATTTGTTGG + Intergenic
945019265 2:205554963-205554985 GGGGATGATTCCCCATTCCTTGG - Intronic
945071440 2:205992753-205992775 GGGGCAGATTCCTCATGTCTCGG - Intergenic
945775767 2:214104362-214104384 TGGTCTGATTCAGCTTTTGTTGG + Intronic
946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG + Intergenic
947182523 2:227424131-227424153 GATCCTGATTCAGCAGTTCTGGG - Intergenic
947767817 2:232648707-232648729 GGCTCTGATTCAGCAGGTCTAGG + Intronic
1169304802 20:4480179-4480201 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1169975101 20:11316429-11316451 GATGCTGATTCAGCAGGTCTAGG + Intergenic
1170421156 20:16194818-16194840 GAGTCTGATTCAGTAGTTCTAGG + Intergenic
1170584036 20:17720944-17720966 GGTGCTGACTCAGCAGGTCTGGG - Intronic
1172802759 20:37589650-37589672 GGCACTAATTCTGCATTTCTGGG - Intergenic
1174255044 20:49248326-49248348 GTGGCAGATCCGGCATTTCTTGG + Exonic
1174395799 20:50246281-50246303 GGGGCAGCATCAGCCTTTCTGGG + Intergenic
1174591168 20:51646186-51646208 AGGGCTTTTTCATCATTTCTTGG + Intronic
1174843722 20:53922998-53923020 AGGGCTGTTTCAGCAGTTATGGG + Intergenic
1175573095 20:60038888-60038910 GAGGCTCATTCAGCAGGTCTGGG + Intergenic
1178226659 21:30726916-30726938 GATGCTGATTCAGTTTTTCTGGG - Intergenic
1178894325 21:36546269-36546291 GAGCCTGATTCAGCATTTCCAGG + Intronic
1181868146 22:25875620-25875642 GGTGCTGATTCAGCCACTCTGGG - Intronic
1182340641 22:29617718-29617740 GGTTCTGATTCAGTAGTTCTGGG + Intronic
1183750776 22:39719205-39719227 GGGATGGATTCAGCATTCCTAGG + Intergenic
1185038473 22:48491405-48491427 GGGGCTCATTCAGCAGTGTTTGG + Intronic
950491009 3:13305119-13305141 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
952327940 3:32337687-32337709 CCTGCTGAATCAGCATTTCTGGG - Intronic
953417537 3:42731544-42731566 GGTTCTGATTCAGCAGGTCTGGG - Intronic
953542594 3:43835353-43835375 GGGGCTAAGGCAGCATTTCAAGG + Intergenic
953724533 3:45386581-45386603 GAGTCTGATTCAGCAGGTCTAGG + Intergenic
953807721 3:46085859-46085881 GAGTCTGATTCAGCATGTCTGGG - Intergenic
954385857 3:50243426-50243448 GGGGCTGTTGCTGCATTTCCAGG - Intronic
955204612 3:56884563-56884585 ATGGCTGATTAAGCATTCCTGGG - Intronic
955783169 3:62507677-62507699 GGTTCTGATTCAGCAGGTCTGGG - Intronic
955999339 3:64712095-64712117 GTGGCTGATTCTGAATTTCCTGG - Intergenic
960165290 3:114394602-114394624 GCTTCTGATTCAGCATGTCTGGG + Intronic
960199164 3:114810916-114810938 GGGGGGGATTAAGAATTTCTAGG + Intronic
961580376 3:127875838-127875860 GGAGCTGATTCAGGATTATTGGG + Intergenic
963523617 3:146388083-146388105 GTGTTTGATTCAGCATGTCTTGG - Intergenic
963536001 3:146529197-146529219 GGCTTTGAGTCAGCATTTCTAGG + Intronic
963649872 3:147965519-147965541 GATTCTGATTCAGTATTTCTGGG - Intergenic
964503914 3:157377647-157377669 GGGGCTGTTTCTGCTTTGCTTGG + Intronic
964663528 3:159148013-159148035 GATTCTGATTCAGCAGTTCTGGG - Intronic
965159724 3:165116805-165116827 GGGGGTGGTTAAGCATTTCATGG + Intergenic
965486165 3:169281185-169281207 GAATCCGATTCAGCATTTCTGGG - Intronic
965678447 3:171224614-171224636 GGGCCTGCTGCAGGATTTCTGGG - Intronic
968470190 4:777268-777290 GTGGCTGAATCTGCATTTCCTGG + Intergenic
969666261 4:8559059-8559081 GAGGCTGAACCAGCATTTCCAGG - Intronic
970672366 4:18411603-18411625 GGTGCTGATTGAGTATATCTGGG - Intergenic
972313495 4:37902926-37902948 AGGGCAGCATCAGCATTTCTTGG - Intronic
972705566 4:41539298-41539320 GTGGCTGATTCAGCAGTCCCGGG + Intronic
974569271 4:63623990-63624012 GAGGCTTATTGAACATTTCTAGG - Intergenic
975611476 4:76208114-76208136 GAGTCTGATTCAGCAAGTCTGGG + Intronic
977902469 4:102438069-102438091 GGGGCAGATCCATCATGTCTTGG + Intergenic
981906100 4:149923574-149923596 GCTGCTAATTCGGCATTTCTGGG + Intergenic
982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG + Intronic
983709371 4:170694902-170694924 GGGGCTTATCCACCATTTTTTGG + Intergenic
985070096 4:186159127-186159149 TGGGCTTACTCAGCATTTATTGG + Intronic
986455622 5:7915026-7915048 GGGGCTCACTGAGCATTTGTTGG - Intergenic
986642510 5:9886432-9886454 GGGGCTGAGGCAGGATTGCTTGG - Intergenic
986819508 5:11449980-11450002 GGGGCTTTTTCAGAACTTCTTGG - Intronic
990981267 5:61604507-61604529 GATTCTGATTCAGCAGTTCTGGG - Intergenic
991145414 5:63297302-63297324 GGTGCTGAGTCAGAATTTCTAGG + Intergenic
995916207 5:117248050-117248072 GATGCTGATTCAGTAGTTCTGGG + Intergenic
998377537 5:141701323-141701345 GGGGCTGTTTCAGCAATACCAGG - Intergenic
1002324135 5:178394399-178394421 GGGGCTGCCTCTGCATTCCTGGG - Intronic
1002980480 6:2131414-2131436 GAGGCTTCTCCAGCATTTCTGGG - Intronic
1003499320 6:6691350-6691372 GGGGCTGAAGCAGCATTCCTAGG - Intergenic
1006453048 6:34116192-34116214 GGTGCTCATTCTGCAGTTCTAGG - Intronic
1006960623 6:37926392-37926414 GGGGCTGCCCCAGCATTCCTGGG + Intronic
1007102847 6:39261821-39261843 GGGGGTGACTATGCATTTCTGGG + Intergenic
1008679941 6:53861475-53861497 GCGACTGATTCAGCAGATCTAGG - Intronic
1009902048 6:69819743-69819765 GGGACTGATTCATTTTTTCTAGG - Intergenic
1011051405 6:83154711-83154733 GGGGGTGATTCTGCCCTTCTTGG - Intronic
1011283818 6:85703754-85703776 TGGGCTGAATCAGCTTTTCCTGG + Intergenic
1014455401 6:121627909-121627931 GGTTCTGATTCAGCAGGTCTTGG + Intergenic
1014633666 6:123817845-123817867 GGTGCTGAATAAGCATTTGTGGG + Intronic
1014991240 6:128079934-128079956 GTTTCTGATTCAGTATTTCTGGG + Intronic
1017183129 6:151573403-151573425 GGGGCAGATTGAGCATGACTGGG + Exonic
1018517455 6:164601395-164601417 GAGGCTGATTCAGCAAGCCTTGG + Intergenic
1018660887 6:166086579-166086601 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1019273362 7:163104-163126 GGGTTTGATTCATCCTTTCTAGG - Intergenic
1019990425 7:4686548-4686570 GGTTCTGATTCAGCTTTGCTTGG + Intronic
1021024310 7:15644515-15644537 GGAGCAGATTCACCTTTTCTTGG - Intronic
1022403682 7:30065931-30065953 GTGTCTGATTCAGCAGGTCTGGG - Intronic
1023592731 7:41796508-41796530 TTGTCTGACTCAGCATTTCTGGG - Intergenic
1024921730 7:54564418-54564440 GGGGCACATTCAGCATTTTCAGG - Intronic
1029264093 7:99325204-99325226 GGGGATGCTCCAGAATTTCTAGG + Intergenic
1029991078 7:104962977-104962999 GGTGCTGATTCAGTAGGTCTGGG + Intergenic
1030866954 7:114711573-114711595 TGGGCTGAATCAGCCTTCCTGGG + Intergenic
1033073869 7:138230442-138230464 GCGGCTGATACAGGTTTTCTGGG - Intergenic
1033262468 7:139855615-139855637 AAGGCTGATTCAGCAGTGCTAGG + Intronic
1035916803 8:3634042-3634064 AGGGCTGACTCAGCACATCTGGG + Intronic
1036385217 8:8273470-8273492 GGTTCTGATTCAGCAGGTCTGGG - Intergenic
1037328158 8:17715983-17716005 GGTGCTTATTGAGCATTTGTTGG - Intronic
1038029441 8:23624320-23624342 GATCCTGATTCAGCAGTTCTGGG + Intergenic
1038058854 8:23889910-23889932 GATTCTGATTCAGCAGTTCTGGG - Intergenic
1038496627 8:28007907-28007929 GGTTCTGATTCAGCAGGTCTGGG - Intergenic
1038629778 8:29230734-29230756 GGTGCTGATTCAGGTCTTCTTGG - Intronic
1039149572 8:34489164-34489186 GGCTCAGACTCAGCATTTCTGGG + Intergenic
1047371832 8:124262318-124262340 GTGACTGATTCAGCATGTCTGGG + Intergenic
1047446079 8:124920911-124920933 GGGGTTGATCCAGTATTTCAGGG - Intergenic
1048420348 8:134272005-134272027 TGTGCTGAGTCAGAATTTCTGGG - Intergenic
1049224451 8:141443127-141443149 TGGGCTGATTCAGCATTCTTGGG + Intergenic
1049737987 8:144220208-144220230 GGCGCTGACTCAGCAGGTCTTGG - Intronic
1055136449 9:72834636-72834658 GGGGCTAAGTGAGCATTTGTAGG - Intronic
1055567473 9:77583687-77583709 GGGGCTGATCAAGGATTTTTTGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057219494 9:93248284-93248306 GGGGCTTTCTCAGCATTTCCCGG + Intronic
1057504352 9:95620349-95620371 GGGGCTGACTAAGCGTTTGTCGG - Intergenic
1057822115 9:98340696-98340718 GGTGCTCCTTCAGCATTTATGGG - Intronic
1057842940 9:98500876-98500898 GTGTCTGATTCAGTAGTTCTGGG - Intronic
1057915593 9:99052962-99052984 GGTTCTGATTCAGCAGGTCTAGG - Intronic
1058817324 9:108696406-108696428 GTGGCTGATTCAGTAGGTCTGGG + Intergenic
1059472441 9:114516234-114516256 GGGGATGATACAGGAATTCTTGG - Intergenic
1059473226 9:114523064-114523086 GGTTCTGATTCAGCAGATCTGGG - Intergenic
1059790760 9:117639549-117639571 AGGGCTGAATCAGCATTTTCTGG + Intergenic
1060191651 9:121597939-121597961 GGGGCTGAGACCCCATTTCTGGG + Intronic
1061574967 9:131500632-131500654 TGGGCTGAGGCAGCAGTTCTCGG + Intergenic
1186516998 X:10173710-10173732 GGTGCTGATTCAGCAGGTCTGGG - Intronic
1186519986 X:10197369-10197391 GTGTCTGGTTCAGCAGTTCTCGG + Intronic
1187257114 X:17653866-17653888 GAGTCTGATTCAGCAGGTCTGGG + Intronic
1192222282 X:69205597-69205619 GGTTCTGATTCAGCAGATCTAGG + Intergenic
1194785554 X:98079680-98079702 GTGGCATATACAGCATTTCTAGG - Intergenic
1196066096 X:111465970-111465992 GGTTCTGATTCAGCACTTCTTGG - Intergenic
1196170138 X:112578591-112578613 GAGACTGAGTCAGCTTTTCTTGG + Intergenic
1196882074 X:120207651-120207673 GAGGCTGAGACAGCCTTTCTGGG + Intergenic
1196948762 X:120854808-120854830 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1197785159 X:130191158-130191180 GGGGCTGCTCCAGCTATTCTGGG - Intergenic
1197902911 X:131392877-131392899 GGGGCTGCTCCAGCTATTCTGGG - Intronic
1199008891 X:142735726-142735748 GAGTCTGATTCAGCAAGTCTGGG + Intergenic
1200234698 X:154462605-154462627 GGGGCTGAGCCAGCATTGCTGGG + Intronic