ID: 982253449

View in Genome Browser
Species Human (GRCh38)
Location 4:153430459-153430481
Sequence CTTTGTGAATGGTATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982253449_982253453 -10 Left 982253449 4:153430459-153430481 CCTACTTTATACCATTCACAAAG No data
Right 982253453 4:153430472-153430494 ATTCACAAAGAGGAATGGCAAGG No data
982253449_982253454 12 Left 982253449 4:153430459-153430481 CCTACTTTATACCATTCACAAAG No data
Right 982253454 4:153430494-153430516 GTCTGAGTCCGAAAGATAATCGG No data
982253449_982253455 18 Left 982253449 4:153430459-153430481 CCTACTTTATACCATTCACAAAG No data
Right 982253455 4:153430500-153430522 GTCCGAAAGATAATCGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982253449 Original CRISPR CTTTGTGAATGGTATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr