ID: 982255452

View in Genome Browser
Species Human (GRCh38)
Location 4:153447057-153447079
Sequence AAGGAGAAGCAGGAGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982255452_982255457 -3 Left 982255452 4:153447057-153447079 CCATCAACCTCCTGCTTCTCCTT No data
Right 982255457 4:153447077-153447099 CTTAACATATTCTCGATGGCAGG No data
982255452_982255458 14 Left 982255452 4:153447057-153447079 CCATCAACCTCCTGCTTCTCCTT No data
Right 982255458 4:153447094-153447116 GGCAGGTTGCTAGTGACATTTGG No data
982255452_982255455 -7 Left 982255452 4:153447057-153447079 CCATCAACCTCCTGCTTCTCCTT No data
Right 982255455 4:153447073-153447095 TCTCCTTAACATATTCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982255452 Original CRISPR AAGGAGAAGCAGGAGGTTGA TGG (reversed) Intergenic
No off target data available for this crispr