ID: 982256537

View in Genome Browser
Species Human (GRCh38)
Location 4:153456753-153456775
Sequence CTTTGGGAGGCCAAGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464672
Summary {0: 711, 1: 22335, 2: 112806, 3: 168357, 4: 160463}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256537_982256546 -3 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256546 4:153456773-153456795 AAGTGCTGGGATTACAGGCGTGG 0: 1142
1: 3395
2: 3470
3: 2707
4: 3182
982256537_982256543 -8 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256543 4:153456768-153456790 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
982256537_982256549 11 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256549 4:153456787-153456809 CAGGCGTGGGGCACCGCGCCCGG 0: 2
1: 239
2: 26326
3: 68923
4: 142505
982256537_982256547 -2 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256547 4:153456774-153456796 AGTGCTGGGATTACAGGCGTGGG 0: 1041
1: 3107
2: 3142
3: 2419
4: 2962
982256537_982256554 24 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256554 4:153456800-153456822 CCGCGCCCGGCTTTGCGGCGGGG No data
982256537_982256551 22 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256537_982256552 23 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256552 4:153456799-153456821 ACCGCGCCCGGCTTTGCGGCGGG No data
982256537_982256548 -1 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256548 4:153456775-153456797 GTGCTGGGATTACAGGCGTGGGG 0: 959
1: 2662
2: 2620
3: 2506
4: 2234
982256537_982256550 19 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256550 4:153456795-153456817 GGGCACCGCGCCCGGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256537 Original CRISPR CTTTGGGAGGCCAAGGCGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr